Background: Recent studies have shown that circular RNA (circRNA) is rich in microRNA (miRNA) binding sites. We have previously demonstrated that the antidepressant effect of ketamine is related to the abnormal expression of various miRNAs in the brain. This study determined the expression profile of circRNAs in the hippocampus of rats treated with ketamine. Methods: The aberrantly expressed circRNAs in rat hippocampus after ketamine injection were analyzed by microarray chip, and we further validated these circRNAs by quantitative reverse-transcription PCR (qRT-PCR). The target genes of the different circRNAs were predicted using bioinformatic analyses, and the functions and signal pathways of these target genes were investigated by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. Results: Microarray analysis showed that five circRNAs were aberrantly expressed in rat hippocampus after ketamine injection (fold change > 2.0, p < 0.05). The results from the qRT-PCR showed that one of the circRNAs was significantly increased (rno_circRNA_014900; fold change = 2.37; p = 0.03), while one was significantly reduced (rno_circRNA_005442; fold change = 0.37; p = 0.01). We discovered a significant enrichment in several GO terms and pathways associated with depression. Conclusion: Our findings showed the abnormal expression of ketamine-induced hippocampal circRNAs in rats.
Keywords: Rat; Ketamine; CircRNA; Hippocampus
Jing Mao and Tianmei Li contributed equally to this work.
The most commonly used antidepressants today effectively improve symptoms of depression, but require at least 2 weeks to take therapeutic effect. In addition, about two-thirds of depressive patients do not respond to the currently available antidepressants and are prone to relapse [[
Recent observations suggest that sub-anesthetic doses of ketamine produce rapid therapeutic effects in depressed patients and in animal models of depression [[
In a prior investigation, we found that the antidepressant effect of ketamine was related to the regulation of multiple microRNAs (miRNAs) in neurons [[
Based on the previous reports, the aim of this study was to determine the effect of an antidepressant dose of ketamine on the expression of circRNAs in the hippocampus of rats and examine a possible circRNA-mediated mechanism for ketamine's action. This work may provide new perspectives on the development of circRNA as a possible drug target.
These experiments were conducted in male Sprague-Dawley rats (50 days old, 150–200 g), provided by Chengdu Dashuo biological technology Co., Ltd., China (experimental animal production license: SCXK Chengdu 2013–17). These rats were housed 5 per cage in standard cages (42 × 20 × 20 cm) in a room. Animals had access to food and water ad libitum during the experiment. The room was maintained at 25–26 °C with about 65% relative humidity, on a 12-h dark/light cycle (lights on at 7 am). All experiments were performed according to National Institute of Health (NIH) guidelines and approved by the ethics committee of Southwest Medical University (Approval number:20180306038).
After 1 week of adaptation, the rats were randomly divided into control and experimental group (12 rats/group). The rats in control group were daily injected with 0.9% saline, whereas the rats in experimental group received ketamine (15 mg/kg). All injections were done intraperitoneally for three consecutive days (the volume of injection was 1 ml/kg). The dose of ketamine used in this study was based on our previous study [[
Relevant circRNAs were analyzed according to our previous approach [[
Hippocampus tissues(n = 6/group) were used for qRT-PCR validation. After RNA isolation, M-MLV reverse transcriptase (Invitrogen, USA) was used for synthesizing cDNA according to the manufacturer's instructions. Subsequently, we performed qRT-PCR using the ViiA 7 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) in a total reaction volume of 10 μl, including 2 μl cDNA, 5 μl 2 × Master Mix, 0.5 μl PCR Forward Primer (10 μM), 0.5 μl PCR Reverse Primer (10 μM) and 2 μl double distilled water. The protocol was initiated at 95 °C for 10 min, then at 95 °C (10 s), 60 °C (60 s) for a total 40 cycles. β-actin was used as a reference. Results were harvested in three independent wells. For quantitative results, the relative expression level of each circRNA was calculated using 2
The candidate miRNA binding sites were searched on the sequences of circRNAs and mRNAs, and the circRNA-miRNA-mRNA interaction were found by the overlapping of the same miRNA seed sequence binding site both on the circRNAs and the mRNA. The miRNA-mRNA interactions were predicted by Targetscan (
Gene Ontology (GO) analysis (
The statistical package for the social sciences (SPSS) 11.0 was selected for statistical analysis. All data were expressed as mean ± SEM. The data from the circRNA microarray and qRT-PCR were analyzed by one-way ANOVA or multi-factorial ANOVA followed by Tukey's post hoc test. P values less than 0.05 with statistically significant differences.
The RNA concentration and purity of all samples meted the requirement (larger than 1.8 and an RNA concentration greater than 30 ng) for subsequent microarray detection of the circRNA expression profile.
As shown in Fig. 1, significantly different circRNAs were selected for hierarchical clustering analysis. The circRNA hierarchical clustering map not only displays circRNA expression, but also exhibits the expression change of a single circRNA from both groups. As shown in Table 1, four circRNAs were upregulated and one was down-regulated in the hippocampus of rats treated with ketamine from circRNA microarray analysis (p < 0.05), but only two of the five circRNAs were confirmed to be differentially expressed from qRT-PCR (Table 3, p < 0.05). As shown in Table 2, the primers for the five different circRNAs were designed using Primer software 5.0.
Graph: Fig. 1 The hierarchical clustering plot of differentially expressed circRNAs (fold change ≥1.5, p < 0.05). Red indicates circRNAs with high expression levels, and green represents circRNAs with low expression levels, the color depth (ranging from black to color) indicates different expression intensities. Each row in the figure indicates a different circRNA, and each column indicates a sample (T is the ketamine group and C is the vehicle group). The left side of the figure shows the circRNA clustering tree, whereas the top shows the hippocampal sample clustering tree
Aberrantly expressed circRNAs in rat hippocampus revealed by microarray analysis (Fold change ≥2.0, p < 0.05)
circRNA Fold Change Regulation rno_circRNA_003460 5.98 up 0.001 rno_circRNA_014900 2.28 up 0.003 rno_circRNA_006565 2.11 up 0.010 rno_circRNA_013109 2.17 up 0.012 rno_circRNA_005442 2.01 down 0.012
A list of primers used for real-time PCR
Gene Bi-directional primer sequence Annealing temperature (°C) Primer length (bp) β-actin (Reference) Forward:5′CGAGTACAACCTTCTTGCAGC 3′ Reverse: 5′ ACCCATACCCACCATCACAC 3' 60 202 rno_circRNA_014900 Forward:5′ CTTAGATGACCTGGAGAAGACCT 3′ Reverse: 5′ TGACTTGGTGCTGTTGACTTTAG 3' 60 124 rno_circRNA_013109 Forward:5′ ATTATAGAGCTAATTACAACTTCCG 3′ Reverse:5′ TTATCTGAAGCATGTTAAGACAATA 3' 60 105 rno_circRNA_006565 Forward:5′ CGACTTCAAAAGAGTTGTGGATT 3′ Reverse: 5′ TTCTCCTCGTGAGCTTTTTTCTC 3' 60 54 rno_circRNA_005442 Forward:5′ ACCCCATGAGAAAGACCAGGTC 3′ Reverse:5′ CTGCTCTCTTCAAGTGAAAGACATC 3′ 60 60 rno_circRNA_003460 Forward:5′ CGCTAAGCATTTCTTTGGAA 3′ Reverse: 5′ GTAGTGGGTGTAGGGAGGAGA 3′ 60 76
As shown in Table 3, the two circRNAs 014900 and 005442 collectively sponged ten miRNAs, namely, rno-miR-466b-5p, rno-miR-6332, rno-miR-6321, rno-miR-193a-5p, rno-miR-1224, rno-miR-323-5p, rno-miR-107-5p, rno-miR-135b-5p, rno-miR-135a-5p, and rno-miR-344b-5p. Each of these miRNAs has target genes that they endogenously regulate, as shown in Table 4, the two circRNAs could indirectly regulate numerous target genes by their endogenous competition mechanism.
qRT-PCR-confirmed expression of circRNAs in rat hippocampus and the predicted target miRNAs
circRNA Fold Change Regulation Predicted target miRNAs rno_circRNA_014900 2.37 up 0.029 rno-miR-466b-5p rno-miR-6332 rno-miR-6321 rno-miR-193a-5p rno-miR-1224 rno_circRNA_005442 2.72 down 0.010 rno-miR-323-5p rno-miR-107-5p rno-miR-135a-5p rno-miR-135b-5p rno-miR-344b-5p
Target genes regulated indirectly by the two differentially expressed circRNAs through miRNAs
circRNA Sponged miRNAs Gene Symbol Gene Description rno_circRNA_014900 rno-miR-193a-5p rno-miR-1224 Nova1 neuro-oncological ventral antigen 1 rno-miR-193a-5p rno-miR-6332 Clasp1 cytoplasmic linker associated protein 1 miR-193a-5p rno-miR-466b-5p Rgs4, Mixl1 regulator of G-protein signaling 4; Mix paired-like homeobox 1 rno-miR-466b-5p rno-miR-6332 Usp37, RGD1566029, Zfp91, Zmiz1, Pbx1 ubiquitin specific peptidase 37; similar to mKIAA1644 protein; zinc finger protein 91; zinc finger, MIZ-type containing 1; pre-B-cell leukemia homeobox 1 rno-miR-466b-5p rno-miR-1224 Calcoco1 calcium binding and coiled coil domain 1 rno-miR-466b-5p rno-miR-6321 Brwd3, Nfat5, Cnot7, Camta1 bromodomain and WD repeat domain containing 3; nuclear factor of activated T-cells 5, tonicity-responsive; CCR4-NOT transcription complex, subunit 7; calmodulin binding transcription activator 1 rno-miR-6332 rno-miR-1224 Prpf4b, Hgs, Gtdc1, Dgkk pre-mRNA processing factor 4B;hepatocyte growth factor-regulated tyrosine kinase substrate; glycosyltransferase-like domain containing 1;diacylglycerol kinase kappa rno-miR-6332 rno-miR-6321 RGD1562037, Usp24,Ssbp2 similar to OTTHUMP00000046255; ubiquitin specific peptidase 24; single-stranded DNA binding protein 2 rno-miR-6332 rno-miR-6321 rno-miR-466b-5p Ssbp2, RGD1562037 singe-stranded DNA binding protein 2; similar to OTTHUMP00000046255 rno-miR-6332 rno-miR-466b-5p rno-miR-1224 Zfp91 zinc finger protein 91 rno_circRNA_005442 rno-miR-107-5p rno-miR-323-5p Eps8,Rhot1 epidermal growth factor receptor pathway substrate 8, ras homolog gene family, member T1 rno-miR-107-5p rno-miR-344b-5p Hn1 hematological and neurological expressed 1 rno-miR-107-5p rno-miR-135b-5p Ptk2,Tiam1 protein tyrosine kinase 2;T-cell lymphoma invasion and metastasis 1 rno-miR-107-5p rno-miR-135a(b)-5p Slc8a1,Man2a1,Tnpo1,Rgl1 solute carrier family 8 (sodium/calcium exchanger), member 1; mannosidase, alpha, class 2A, member 1;transportin 1; ral guanine nucleotide dissociation stimulator,-like 1 rno-miR-323-5p rno-miR-344b-5p Tomm6 translocase of outer mitochondrial membrane 6 homolog (yeast) rno-miR-323-5p miR-135a(b)-5p Shisa7 shisa family member 7 rno-miR-344b-5p miR-135a(b)-5p Arel1 apoptosis resistant E3 ubiquitin protein ligase 1 rno-miR-323-5p rno-miR-107-5p rno-miR-135a(b)-5p Rhot1 ras homolog gene family, member T1
As shown in Fig. 2, the molecular functions (MFs) of neurons that may be regulated by the target genes of the differentially expressed circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). The classification of notable MFs was shown in Fig. 2a and b shows the order of these MFs by their GO analysis enrichment scores. Figure 2c shows the notable activities of neurons using fold enrichment. The detailed list of the genes identified as regulated by circRNA was shown in Additional files 1 and 2.
Graph: Fig. 2 The molecular functions (MFs) of neurons regulated by the target genes of the differentially expressed circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). a classifies the notable MFs and b shows these same MFs ordered by their GO analysis enrichment scores. c shows the notable activities of neurons that may be regulated by target genes predicted using fold enrichment
As shown in Fig. 3, the biological processes (BPs) in neurons that may be regulated by target genes of the two circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). The classification of notable BPs was shown in Fig. 3a and b shows the different BPs predicted by enrichment scores. Figure 3c shows the different BPs of neurons predicted using fold enrichment. The detailed list of the genes identified as regulated by circRNA was shown in Additional files 3 and 4.
Graph: Fig. 3 The biological processes (BPs) in neurons regulated by target genes of the two circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). a classifies the predicted BPs and b shows the notable BPs predicted by enrichment scores. c shows the notable BPs of neurons that may be regulated by target genes predicted using fold enrichment
As shown in Fig. 4, the cellular components (CCs) that may be regulated by target genes of the two differentially expressed circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). The classification of notable CCs was shown in Fig. 4a and b shows the different CCs predicted by enrichment scores. Figure 4c shows the different CCs of neurons using fold enrichment. The detailed list of the genes identified as regulated by circRNA was shown in Additional files 5 and 6.
Graph: Fig. 4 The cellular components (CCs) that may be regulated by target genes of the two differentially expressed circRNAs (p < 0.05, left: rno_circRNA_014900; right: rno_circRNA_005442). a classifies the predicted CCs and b shows the notable CCs predicted by enrichment scores. c shows the notable CCs of neurons that may be regulated by target genes predicted using fold enrichment
Tables 5 and 6 shows the signaling pathways that may be regulated by target genes of the differentially expressed rno_circRNA_014900 and rno_circRNA_005442 (p < 0.05). The identified pathways were involved in the regulation of central nervous system functions, such as Wnt signaling, long-term depression, PI3K-Akt signaling, dopaminergic synapse activity, mTOR signaling, p53 signaling, apoptosis, TGF-beta signaling, axon guidance, hippo signaling, and MAPK signaling.
The signaling pathways that may be regulated by targeted genes of the differentially expressed rno_circRNA_014900(p < 0.05)
PathwayID Definition Fisher-Pvalue Enrichment_Score rno04510 Focal adhesion - 4.05765E-06 5.391726 rno05205 Proteoglycans in cancer - Rattus norvegicus (rat) 0.000263739 3.578826 rno05200 Pathways in cancer - Rattus norvegicus (rat) 0.000839484 3.075988 rno04216 Ferroptosis - Rattus norvegicus (rat) 0.000947662 3.023347 rno04015 Rap1 signaling pathway - Rattus norvegicus (rat) 0.001242467 2.905715 rno00564 Glycerophospholipid metabolism - Rattus norvegicus (rat) 0.001767738 2.752582 rno04310 Wnt signaling pathway - Rattus norvegicus (rat) 0.002533546 2.596271 rno05165 Human papillomavirus infection - Rattus norvegicus (rat) 0.003213976 2.492957 rno04140 Autophagy - animal - Rattus norvegicus (rat) 0.00464105 2.333384 rno05222 Small cell lung cancer - Rattus norvegicus (rat) 0.005031787 2.298278 rno04070 Phosphatidylinositol signaling system - Rattus norvegicus (rat) 0.006461245 2.189684 rno00561 Glycerolipid metabolism - Rattus norvegicus (rat) 0.00791785 2.101393 rno04213 Longevity regulating pathway - multiple species - Rattus norvegicus (rat) 0.00791785 2.101393 rno04730 Long-term depression - Rattus norvegicus (rat) 0.00791785 2.101393 rno04151 PI3K-Akt signaling pathway - Rattus norvegicus (rat) 0.00874211 2.058384 rno04512 ECM-receptor interaction - Rattus norvegicus (rat) 0.009516369 2.021529 rno04137 Mitophagy - animal - Rattus norvegicus (rat) 0.009920558 2.003464 rno04728 Dopaminergic synapse - Rattus norvegicus (rat) 0.01248382 1.903653 rno04211 Longevity regulating pathway - Rattus norvegicus (rat) 0.01286284 1.890663 rno04136 Autophagy - other - Rattus norvegicus (rat) 0.01346501 1.870793 rno04150 mTOR signaling pathway - Rattus norvegicus (rat) 0.01358861 1.866825 rno04115 p53 signaling pathway - Rattus norvegicus (rat) 0.01402018 1.853246 rno04215 Apoptosis - multiple species - Rattus norvegicus (rat) 0.01492946 1.825956 rno05214 Glioma - Rattus norvegicus (rat) 0.01496318 1.824976 rno04270 Vascular smooth muscle contraction - Rattus norvegicus (rat) 0.02428063 1.61474 rno01521 EGFR tyrosine kinase inhibitor resistance - Rattus norvegicus (rat) 0.02549639 1.593521 rno05219 Bladder cancer - Rattus norvegicus (rat) 0.02580699 1.588263 rno05224 Breast cancer - Rattus norvegicus (rat) 0.02850884 1.54502 rno05166 HTLV-I infection - Rattus norvegicus (rat) 0.02925304 1.533829 rno04066 HIF-1 signaling pathway - Rattus norvegicus (rat) 0.03188594 1.496401 rno04068 FoxO signaling pathway - Rattus norvegicus (rat) 0.03490339 1.457132 rno04144 Endocytosis - Rattus norvegicus (rat) 0.03599259 1.443787 rno04720 Long-term potentiation - Rattus norvegicus (rat) 0.03856442 1.413813 rno04978 Mineral absorption - Rattus norvegicus (rat) 0.04045532 1.393024 rno04725 Cholinergic synapse - Rattus norvegicus (rat) 0.04272807 1.369287 rno05030 Cocaine addiction - Rattus norvegicus (rat) 0.04327309 1.363782 rno04010 MAPK signaling pathway - Rattus norvegicus (rat) 0.04346333 1.361877 rno04120 Ubiquitin mediated proteolysis - Rattus norvegicus (rat) 0.04667443 1.330921 rno00062 Fatty acid elongation - Rattus norvegicus (rat) 0.04768946 1.321578 rno05211 Renal cell carcinoma - Rattus norvegicus (rat) 0.04775832 1.320951 rno01522 Endocrine resistance - Rattus norvegicus (rat) 0.04798442 1.3189
The signaling pathways that may be regulated by targeted genes of the differentially expressed rno_circRNA_005442 (p < 0.05)
PathwayID Definition Fisher-Pvalue Enrichment_Score rno04350 TGF-beta signaling pathway - Rattus norvegicus (rat) 0.002056745 2.68682 rno04960 Aldosterone-regulated sodium reabsorption - Rattus norvegicus (rat) 0.002806053 2.551904 rno05231 Choline metabolism in cancer - Rattus norvegicus (rat) 0.0039363 2.404912 rno05412 Arrhythmogenic right ventricular cardiomyopathy (ARVC) - Rattus norvegicus (rat) 0.005000479 2.300988 rno04550 Signaling pathways regulating pluripotency of stem cells - Rattus norvegicus (rat) 0.005251424 2.279723 rno04218 Cellular senescence - Rattus norvegicus (rat) 0.005747859 2.240494 rno04360 Axon guidance - Rattus norvegicus (rat) 0.005747859 2.240494 rno05225 Hepatocellular carcinoma - Rattus norvegicus (rat) 0.005747859 2.240494 rno04144 Endocytosis - Rattus norvegicus (rat) 0.006773032 2.169217 rno00510 N-Glycan biosynthesis - Rattus norvegicus (rat) 0.007410522 2.130151 rno04390 Hippo signaling pathway - Rattus norvegicus (rat) 0.009694587 2.013471 rno04068 FoxO signaling pathway - Rattus norvegicus (rat) 0.01587784 1.799209 rno04371 Apelin signaling pathway - Rattus norvegicus (rat) 0.02058289 1.686494 rno04520 Adherens junction - Rattus norvegicus (rat) 0.02501545 1.601792 rno05210 Colorectal cancer - Rattus norvegicus (rat) 0.02501545 1.601792 rno04973 Carbohydrate digestion and absorption - Rattus norvegicus (rat) 0.02580168 1.588352 rno04010 MAPK signaling pathway - Rattus norvegicus (rat) 0.03810185 1.419054 rno05410 Hypertrophic cardiomyopathy (HCM) - Rattus norvegicus (rat) 0.04204027 1.376335 rno05414 Dilated cardiomyopathy (DCM) - Rattus norvegicus (rat) 0.04832562 1.315823
There are about 340 million patients suffering from depression around the world, and it is estimated that up to 1 million people die by depression-induced suicide every year. Therefore, depression has become a global public health problem [[
Recent many researches have shown that many transcriptional products come from the non-coding RNA (ncRNA), including the microRNA (miRNA), long non-coding RNA (lncRNA), and circular RNA (circRNA), these ncRNAs can regulate gene expression at the DNA level, pre-transcriptional level, transcriptional level, post-transcriptional level, translational level, and post-translational level [[
Our results showed that the expression of rno_circRNA_014900 was significantly increased by ketamine, while the expression of rno_circRNA_005442 was obviously decreased. Since these two circRNAs were not investigated in previous studies on depression, we further investigated their regulated target genes and signaling pathways. Competing endogenous RNA analysis found that the rno_circRNA_014900 could sponge rno-miR-466b-5p, rno-miR-6332, rno-miR-6321, rno-miR-193a-5p and rno-miR-1224, whereas the rno_circRNA_005442 had the binding sites in rno-miR-323-5p, rno-miR-107-5p, rno-miR-135a-5p, rno-miR-135b-5p and rno-miR-344b-5p. In a prior investigation, we found that miR-206 was a critical novel gene for the expression of BDNF (brain-derived neurotrophic factor) induced by ketamine [[
The results from GO analysis found that the the target genes of the two circRNAs regulated many molecular functions (including protein phosphatase binding, SUMO binding, Wnt-protein binding, etc.), biological processes (including adherens junction assembly, neuron projection morphogenesis, neurological processes, etc.), and cellular components (including dendritic spines, AMPA-glutamate receptor binding, neuronal cell body, etc.). The results from KEGG pathway prediction showed that the signaling pathways regulated by target genes of the two circRNAs included Wnt signaling, long-term depression, PI3K-Akt signaling, dopaminergic synapses, mTOR signaling, p53 signaling, apoptosis, MAPK signaling, TGF-beta signaling, axon guidance, Hippo signaling, etc.. These signaling pathways may be involved in the occurrence and development of depression, because some researches found that the Wnt signaling pathway played important roles in the depression-like behaviors [[
As we analyzed in other study about circRNAs [[
In summary, we found that ketamine treatment resulted in the abnormal expression of the two circRNAs in the hippocampus of rats, and these two circRNAs may be associated with stress-related depression disorders. CircRNAs should remain the focus of researches investigating antidepressant targets because they have considerable potential in the clinical treatment of stress-related depression. As an invaluable topic for future biomedical studies, we plan to screen for specific circRNAs in the context of depression and to examine their potential value in the diagnosis and treatment of this debilitating disorder.
This work was supported by the Projects of the National Natural Science Foundation of China (Grant No. 81271478), Department of Science &Technology of Sichuan Province (Grant No. 14JC0093), Department of Education of Sichuan Province (Grant No. 14ZA0142) and Department of Science &Technology of Luzhou City (Grant No. 2015-S-46). The funding bodies had no role in the design of the study or collection, analysis, and interpretation of data or in writing the manuscript.
We would like to thank LetPub (
JM, TL, DF, HZ, JF, LL and XW made substantial contribution to conception of the intervention and design of the study and/or were involved in acquisition of data. JM, TL, DF and HZ made the first draft of the manuscript and LL, CZ and XW critically revised the manuscript. All authors read and approved the final manuscript.
The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
All experimental procedures involving animals were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals and the Chinese Society for Neuroscience and Behavior recommendations for animal care. All of the experiments involving surgeries and treatments were approved by the ethics committee of Southwest Medical University (Ethics number: 20180306038).
Not applicable.
The authors declare that they have no competing interests.
Graph: Additional file 1. MF results for circRNA01490. The detailed list of the genes identified as regulated by the circRNA 01490, MF: molecular function.
Graph: Additional file 2. MF results for circRNA005442. The detailed list of the genes identified as regulated by the circRNA005442, MF: molecular function.
Graph: Additional file 3. BP results for circRNA01490. The detailed list of the genes identified as regulated by the circRNA 01490, BP: biological process.
Graph: Additional file 4. BP results for circRNA005442. The detailed list of the genes identified as regulated by the circRNA005442, BP: biological process.
Graph: Additional file 5. CC results for circRNA01490. The detailed list of the genes identified as regulated by the circRNA 01490, CC: cellular component.
Graph: Additional file 6. CC results for circRNA005442. The detailed list of the genes identified as regulated by the circRNA005442, CC: cellular component.
• BPs
- Biological processes
• CCs
- Cellular components
• ceRNA
- Competitive endogenous RNA
• circRNA
- Circular RNA
• GO
- Gene Ontology
• i.p.
- Intraperitoneal
• KEGG
- Kyoto Encyclopedia of Genes and Genomes
• lncRNA
- Long non-coding RNA
• MFs
- Molecular functions
• miRNA
- MicroRNA
• ncRNA
- Non-coding RNA
• qRT-PCR
- Quantitative reverse-transcription PCR
• SEM
- Standard error of the mean
Supplementary information accompanies this paper at 10.1186/s12888-019-2374-2.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Jing Mao; Tianmei Li; Di Fan; Hongli Zhou; Jianguo Feng; Li Liu; Chunxiang Zhang and Xiaobin Wang
Reported by Author; Author; Author; Author; Author; Author; Author; Author