Background: Human herpesviruses (HHVs) remain latent after primary infection and can be reactivated in response to immunosuppression and chemotherapy. Little is known about their incidence, potential relationships, risk factors and clinical impact in non-transplant leukemia patients. This study investigated prospectively incidence, risk factors, clinical impact and possible association of HHVs-(1–7) infections in patients with newly diagnosed acute leukemia. Methods: Study design involved longitudinal sampling before chemotherapy and in different phases of chemotherapy: post-induction, post-remission, and post-salvage during 2016–2018. A total of 734 plasma samples from 95 patients were analyzed by a qualitative, multiplex PCR for HHVs detection and a quantitative real-time PCR was used for cytomegalovirus (CMV) quantification. HHVs-(1–6) IgG and IgM antibodies were tested using immunoassays. Risk factors were analyzed by binary logistic regression and relationships between viruses were analyzed using the Chi-square or Fisher's exact test as appropriate. Results: The overall seroprevalences of HHV-(1–6) IgG were high (> 80%). At least one herpes viral agent was detected in 60 patients (63.3%). CMV was the most commonly detected virus in the different phases of chemotherapy (19.4%), followed by HHV-6 (9.7%), HHV-7 (5.2%) and EBV (2.7%). HSV-1/2 and VZV DNA were not detected. Twenty-seven patients (28.4%) had more than one virus detected in the follow-up, with 23 who were co-infected. CMV/HHV-6 was the most frequent co-infection (69.5%, 16/23). HHV-6 infection (p = 0.008) was identified as a risk factor for CMV infection while salvage treatment (p = 0.04) and CMV infection (p = 0.007) were found to be independent risk factors for HHV-6 infection. CMV co-infection was associated with severe lymphopenia with an absolute lymphocyte count (ALC) (< 500/μL) (p = 0.009), rash (p = 0.011), pneumonia (p = 0.016) and opportunistic infections [bacteremia, p < 0.001 and invasive fungal infection, (p = 0.024)] more frequently than CMV mono-viral infections. Conclusions: Our data suggest that co-infection with HHVs, especially CMV and HHV-6, may contribute to the development of serious clinical manifestations with profound lymphopenia, pneumonia rash and increased risk for bacterial and fungal co-infections. These findings may suggest the synergistic effect of HHVs associated infection.
Keywords: Herpesviruses; Chemotherapy; Acute leukemia; Co-infection
Until recently, viral infections in patients with hematological malignancies were concerns primarily the allogeneic hematopoietic stem cell transplant (allo-HSCT) recipients. The current large increase of intensive immunosuppressive chemotherapy regimens particularly in non-transplanted patients with hematological malignancies had a potential impact on increasing the incidence of viral infections in this group [[
After immunosuppression, viral infections may result from a new infection or from reactivation of latent infections. Viruses commonly involved are human herpesviruses (HHVs) that are divided into three groups: alpha (α), beta (β), and gamma (γ) HHVs. Herpes simplex virus 1,2 (HSV-1 and HSV-2) and varicella-zoster virus (VZV) are α-HHV, cytomegalovirus (CMV), human herpesvirus 6A,6B (HHV6-A and HHV-6B), and 7 (HHV-7) are β-HHVs while Epstein-Barr virus (EBV) and human herpesvirus 8 (HHV-8) are γ-HHVs [[
CMV is one of the most important viruses of this family and is the subject of active research in allo-HSCT setting. Nevertheless, there is very little information about its incidence, its role and its impact in other hematologic settings, especially in leukemic patients. Similarly, in these settings, poor data is available concerning the other HHVs which can also lead to severe diseases. Most existing studies consist of retrospective analyses and case series whereas only limited information is available from prospective studies [[
Given their seriousness, considerable attention has been devoted to investigating factors that might increase their severity in allo-HSCT recipients. The major risk factors for CMV recurrence in non-transplant settings are the advanced disease, poor performance status and use of high dose steroids, fludarabine, alemtuzumab, bortezomib, and rituximab [[
This study aimed to evaluate prospectively the incidence of HHV infections in consecutive patients with acute leukemia at different stages of chemotherapy. The relationships among these viruses, their potential risk factors and especially the co-infection of CMV with other HHVs and its impact on clinical manifestations were analyzed.
This prospective study conducted between January 2016 and December 2018, included 95 patients with newly diagnosed acute leukemia, 52 acute lymphoblastic leukemia (ALL) (39 B-cell ALL and 13 T-cell ALL) and 43 acute myeloid leukemia (AML) who were diagnosed and treated at the Department of Hematology of Farhat Hached University Hospital. All patients were subject to a pretreatment assessment, including a complete history and physical examination, as well as routine baseline investigations required for diagnosis and staging according to each disease category by referring to the WHO criteria. Initial treatment regimens included for almost all patients two-chemotherapy phases: induction and post-remission therapy. After induction therapy, eligible patients with high-risk disease and a matched donor may go on to allo-HSCT while all others were assigned to post-remission therapy (consolidation and maintenance). Complete remission (CR) was retained when blasts cells percentage was less than 5% in the bone marrow samples without evidence of circulating blasts or extramedullary disease and with the recovery of peripheral counts. On the basis of their responses to induction therapy patients were distributed into two groups; patients with CR and patients with treatment failure (chemoresistance) when evaluation did not meet the criteria of CR. Salvage treatments were selected in case of primary refractory when bone marrow still had more than 5% of blasts at the end of the first or the second identical induction or at relapsed acute leukemia when the recurrence of disease is after CR.
The exclusion criteria included: preexisting cancer; hematological, or immunological diseases, and chronic viral infections (human immunodeficiency virus, hepatitis B or C). Patients, who received allogeneic or autologous hematopoietic stem cell transplantation, were excluded from this study upon beginning preconditioning for transplantation. Patients enrolled in this study did not receive any CMV specific antiviral therapy.
Our study design involved prospective sampling at the time of diagnosis (before chemotherapy) and in the different phases of chemotherapy, post-induction, post-remission and post-salvage chemotherapy. Follow-up samples were collected at a later time in the same period with the aim to properly evaluate the occurrence of herpes viral infections. For some patients, the number of follow-ups was limited due to early death or loss to follow-up samples. The median follow-up duration was 7.4 months range (1–36) from the start of chemotherapy. There are 734 blood specimens, (3–20) samples per patient with a median of seven samples per patient from which all plasma samples were isolated and stored at − 80 °C until DNA extraction. The study was approved by the Ethics Committee and Medical Research of Farhat Hached University Hospital of Sousse, ref: IRB registration number assigned by OHRP: IRB00008931 and informed consent was obtained from all participants enrolled in the study.
Serum samples from all 95 patients before starting chemotherapy were tested by commercially available diagnostic kits. Enzyme-linked immunosorbent assay (ELISA) testing kit (Euroimmun, Germany) was used to test HSV-1/2 and VZV specific antibodies (IgG and IgM). Epstein-Barr nuclear antigen-1 (EBNA-1) EBNA-1 IgG and viral capsid antigen VCA EBV IgM, CMV IgG and IgM were analyzed with chemiluminescence assays by the Abbott Architect i2000SR and CMV IgG avidity by a commercial kit (Euroimmun, Germany) to assess whether or not the infection was primo-infection. Immunofluorescence assay kits (DiaSorin, Italy) were used to test the HHV-6 IgG and HHV-6 IgM antibodies. The interpretation of the serological tests followed the manufacturer's instructions.
DNA was extracted from a 200-μL of plasma using a QIAamp DNA Mini Kit (QIAGEN, Germany), according to the manufacturer's instructions and DNA was eluted in a final volume of 50 μL. Multiplex PCR was performed as described previously by Tanaka et al to amplify HHVs DNA (HSV-1/2, VZV, EBV, CMV, HHV-6A/B, and HHV-7) [[
Primers used for multiplex PCR of human herpesviruses in the study
Viruses (GenBank accession) Primer Primer sequence (5′-3′) Position Product length (bp) HSV-1/2 (HSV-1:M10792, HSV-2: M16321) HSV-F ATCCAGTACGTCTTTGTGGAGCCCAAG HSV-1:3389 292 HSV-2:3058 HSV-R HSV-1:3680 HSV-2:3349 VZV (X04370) VZV-F 49651 161 VZV-R 49811 EBV (NC_007605) EBV-F 153240 229 EBV-R ATCCAGTACGTCTTTGTGGAGCCCAAG 153468 CMV (NC_001347) CMV-F GCGCGTACCGTTGAAAGAAAAGCATAA 80362 131 CMV-R TGGGCACTCGGGTCTTCATCTCTTTAC 80492 HHV6A/B (HHV6A: NC_001664,HHV6B: AB021506) HHV6-F ATGCGCCATCATAATGCTCGGATACA HHV-6A: 57837 183 HHV-6B: 58791 HHV6-R CCCTGCATTCTTACGGAAGCAAAACG HHV-6A: 58019 HHV-6B: 58973 HHV7 (NC_001716) HHV7-F GCCCGTTTTCGGAAATATTGGAGAGAT 55671 347 HHV7-R ACGCACGAGACGCACTTTTCTTAAACA 56017
Primers and targets used in the Multiplex PCR assay for the simultaneous detection of herpesviruses (HSV-1/2, VZV, EBV, CMV, HHV-6A/B, and HHV-7). Each primer pair was designed with different amplicon size to identify each product with agarose gel electrophoresis
CMV viral load was performed in the first positive plasma samples (multiplex PCR) using artus CMV RG PCR kit (Qiagen, Germany) and Rotor-Gene Q (RGQ) instrument, according to the manufacturer's recommendations. Results were recorded in copies/mL. The lower limit of detection for this assay is 57.1 copies/mL. High-level CMV DNAemia was defined in this study, as having quantitative CMV DNA in plasma ≥1000 copies/mL.
In this paper, definitions of viral infections were those according to published criteria [[
Patients with more than one virus detected at one or more time points were classified as DNAemia caused by multiple viruses. Mono-viral infection was defined as the presence of DNA of one HHV detected at one or more time-point. A viral co-infection was assigned as the detection of DNA of more than one type of HHVs in the same sample. Dual and triple viral infections were defined as the presence of DNA of two and three different types of viruses, accordingly in the same sample.
We evaluated the hospital records of the patients and the daily clinical features for each day in which we tested a blood sample and investigated whether the patient had fever defined as ≥38.5 °C or > 38.0 °C that persisted for one hour, severe neutropenia with an absolute neutrophil count (ANC) of ≤500 cells/ μL; and prolonged neutropenia was defined if it persisted over 7 days; severe lymphopenia: with an absolute lymphocyte count (ALC) < 500/μL; thrombocytopenia: platelet count < 100 10
The representation of patient's data and detected viral infections were analyzed using the SPSS 20.0 statistical package. The number of infections was expressed as the prevalence within a given phase of therapy and it is a simple fraction of the number of patients experiencing at least one given infection compared to all patients undertaking the same phase of therapy. The Venn diagram was constructed by using a free online tool (
Viral DNA findings were modeled as dichotomous variables and coded as positive at any level, that is to say no limit in the copy number exists for the distinction between a viral acute infection and latency. Thus, we labeled these viral DNA findings as infections, regardless of copy number. Univariate logistic regression analysis of risk factors for HHVs infections was performed, showing the association between viral infections and patient's demographic and clinical characteristics using the Chi-square (X
Ninety-five newly diagnosed acute leukemia patients aged 1–64 years (mean 16) at the time of diagnosis were prospectively enrolled in the follow-up study before starting induction therapy. Patients' characteristics are presented in Fig. 1. The male/female sex ratio was 1.96. The median follow-up duration was 4.8 months range (1–22.5) for patients with AML and 12.73 months range (1.1–36) for ALL. Seventy patients out of 95 had clinical and laboratory evidence of first remission after induction therapy, while 15 had primary refractory disease and 10 died (8 AML and 2 ALL) in aplasia. Fifty-four out of 70 patients were on continuous CR after post-remission therapy, 14 were in first relapsed and 2 AML patients died. Twenty-nine patients with relapsed or refractory acute leukemia were treated with salvage regimens. Eighteen out of 29 patients achieved CR following salvage therapy, whereas 6 patients were refractory and 5 ALL patients died at the end of the study. Overall we evaluated 734 plasma tests: 95 (from 95 patients), 247 (from 95 patients), 257 (from 70 patients), and 135 (from 29 patients) before chemotherapy, post-induction, post-remission, post-salvage, respectively.
Graph: Fig. 1 Patients' flow chart depicting the process of enrollment for analysis. Acute leukemia patients were enrolled in the study at different phases of chemotherapy: before chemotherapy, post-induction, post-remission and post-salvage
The overall IgG prevalences were 95% (91/95), 84,2% (80/95), 81% (77/95), 94,7% (90/95) and 97,9% (93/95) for HSV1/2, VZV, EBV, CMV and HHV-6 respectively, while the corresponding IgM prevalences were 3% (3/95),3% (3/95), 4% (4/95),5% (5/95) and 2% (2/95) respectively. The avidity of IgG antibodies against CMV was high in all these patients indicating past exposure.
Of the 95 patients, 60 were tested positive in at least one of their samples to at least one of the HHVs analyzed; 33 (34.7%) patients were single infected and 27 (28.4%) were multiply infected; 21 of these with two viruses and 6 with three viruses. Of 734 samples, 170 samples were positive for one or more viruses. Among all positive viral detections, 120 samples were single positive viral detection of which 93 were positive to CMV, 17 to HHV-6, 7 to HHV-7 and 3 to EBV. A total of 50 samples showed positive viral detection to more than one HHVs; 44 were dual infections and 6 were triple infections (Fig. 2). None of the samples examined were HSV-1, 2 and VZV positive. Neither patients at diagnosis with positive HHVs IgM nor patients with negative HHVs serology developed HHVs active infection during the study. There was no significant difference between AML and ALL groups regarding the presence of HHVs (Table 2).
Graph: Fig. 2 Single infections and co-infections detected in acute leukemia patients. Venn diagram shows the number of positive samples for each HHVs. Numbers of single infections can be seen at the ends of the diagram (N = 120), while co-infections can be seen at overlapping areas (N = 50)
Distribution of herpesviruses in leukemic patients (ALL or AML)
Viral infection Patients Patients with AML Patients with ALL 21 (22.1) 12 (27.9) 9 (17.3) 0.227 3 (3.1) – 3 (5.8) 0.248 5 (5.3) 2 (4.6) 3 (5.8) 1.000 4 (4.2) – 4 (7.7) 1.000 15 (15.8) 5 (11.6) 10 (19.2) 0.401 5 (5.3) 4 (9.3) 1 (2) 0.172 1(1.1) – 1 (2) 1.000 2(2.1) 2 (4.6) – 0.202 2(2.1) 1 (2.3) 1 (2) 1.000 1(1.1) 1 (2.3) – 0.452 1(1.1) – 1 (2) 1.000 35(36.8) 16 (37.2) 19 (36.5) 1.000 60(63.2) 27 (62.8) 33 (63.5) 1.000
The patients were divided into two main groups according to the type of leukemia: (
Among all the patients, CMV was the most frequently identified HHVs 48.4% (46/95), followed by HHV-6 26.3% (25/95), HHV-7 14.7% (14/95) and EBV 8.4% (8/95). Fifteen patients (15.8%) were infected with CMV and HHV-6, of whom five tested positive for HHV6 first, three for CMV first, and seven for both simultaneously. Five patients (5.3%) were infected with CMV and HHV-7, of whom two tested positive for CMV first and one for HHV-7 first and two for both simultaneously. One patient (1%) was co-infected with both EBV and HHV-7 at the same time. Two patients (2.1%) were infected with CMV, HHV-6 and HHV-7, of whom one tested positive for both HHV-6 and HHV-7 first and one patient with all three viruses simultaneously. Two patients (2.1%) were infected with CMV, EBV and HHV-6, of whom one tested positive simultaneously for CMV and EBV first and one patient with both EBV and HHV-6. One patient (1%) was infected with three viruses, EBV and HHV-7 simultaneously then HHV-6. Finally, one patient (1%) was co-infected with EBV and HHV-7 then CMV. Out of the overall 84 HHVs distinct infections (from 60 patients), 61 were single infections and 23 were co-infections. For a single patient, the total number of any HHVs positive infections ranged from 1 to 4 (45 patients had only one positive detection, 8 patients had 2 positive distinct detections, 5 patients had 3 distinct positive detections and 2 patients had 4 positive distinct detections). Follow-up samples were collected; for an individual patient, the total number of HHVs positive plasma samples detected ranged from 1 to 9 (17 patients had 1 positive sample, 16 patients had 2, 6 patients had 3, 5 patients had 4, 16 patients had ≥5 positive samples). All the sequences of the first PCR products confirmed their viral identity when compared to NCBI web site sequences. The overall prevalence of CMV DNAemia (≥57.1 copies/mL) and high-level CMV DNAemia (≥1000 copies/mL) were obtained in 65.5% (38/58) and 34.5% (20/58) of viral detections.
Samples with high-level CMV DNAemia were detected both in post-remission and at salvage phase of chemotherapy and not before chemotherapy.Twelve recurrent infections of CMV DNAemia were detected. A second recurrent infection was reported in eight patients; half of them after remission chemotherapy (consolidation) and a half after salvage chemotherapy and a third recurrent infection was reported at salvage chemotherapy in two patients who had previously tested positive; one before chemotherapy and after consolidation and one after induction and consolidation chemotherapy. Three recurrent infections of HHV-6 DNAemia were present in two patients; one had the first episode at post-remission, then a second one at salvage chemotherapy and the other patient had two recurrent infections; one at diagnosis then one at induction and another one at post-remission. Only one recurrent infection of HHV-7 DNAemia was present in one AML patient.
Table 3 demonstrates the prevalence of HHVs classified by phases of chemotherapy. According to each period, CMV DNAemia was detected in 8.4, 14.7, 27.1, and 51.7% before chemotherapy, at post-induction, post-remission, and after salvage, respectively. The prevalence of CMV DNAemia was significantly higher at salvage than before chemotherapy or post-induction (p < 0.05). HHV-6 DNAemia was detected in 1, 3.15, 2.8 and 7% before chemotherapy, at post-induction, post-remission, and after salvage, respectively.
Presence of herpesviruses DNA according to the different chemotherapy phases as detected by multiplex PCR
Viral detection Before chemotherapy Post- induction Post -remission After salvage All periods 8 (8.4) 14 (14.7) 19 (27.1) 15 (51.7) 56 (19.4) 1 (1) 3 (3.15) 2 (2.8) 2 (7) 8 (2.7) 1 (1) 8 (8.4) 9 (12.9) 10 (34.5) 28 (9.7) 1 (1) 6 (6.3) 3 (4.2) 5 (17.2) 15 (5.2) 86 (90.5) 74 (78) 46 (65.7) 7 (24.1) 213 (73.7) 9 (9.5) 21 (22) 24 (34.3) 22 (75.9) 76 (26.3)
The prevalence of viral infections during the different phases of chemotherapy: before chemotherapy, post-induction, post-remission and after salvage
The prevalence of HHV-6 DNAemia was significantly higher at different stages of chemotherapy than before chemotherapy (p < 0.05) and higher at salvage than at post-induction or at post-remission (p < 0.05). EBV DNAemia was detected rarely in 1, 3.15, 2.8 and 7% before chemotherapy, at post-induction, post-remission, and after salvage, respectively. HHV-7 DNAemia was detected in 1, 6.3, 4.2 and 17.2% before chemotherapy, at post-induction, post-remission, and after salvage, respectively. The prevalence of HHV-7 DNAemia was significantly higher at salvage than before chemotherapy or at post-induction (p < 0.05).
In the univariate analysis, risk factors for CMV infection were the presence of relapse (p = 0.033, OR = 2.455), receiving salvage chemotherapy (p = 0.027, OR = 4.885) and the occurrence of HHV-6 infection (p = 001, OR = 5.043). Presence of relapse (p = 0.014, OR = 3.2), receiving salvage chemotherapy (p = 0.007, OR = 3.656) and the occurrence of CMV infection were significantly associated with increased risk of HHV-6 infection (p = 001, OR = 5.043).
Interestingly, 76% of HHV-6 infections were followed by a CMV infection. HHV-7 infection was associated with an increased risk of EBV infection with borderline significance and vice versa (p = 0.09). Other potential risk factors, such as gender, age, type of leukemia and response to induction were not found to be risk factors for CMV, EBV, HHV-6 and HHV-7 infections. After binary logistic analysis, only HHV-6 infection (OR 4.205, p = 0.008) was identified as an independent risk factor for CMV infection while, salvage treatment (OR 2.887, p = 0.04) and CMV infection (OR 4.265, p = 0.007) remained as independent risk factors for HHV-6 infection (Table 4).
Risk factors for the development of viral infection. Patient-Level: (at least one positive PCR-result)
Risk Factors (Univariate analysis) CMV infection EBV infection HHV-6 infection HHV7- infection Patients Data Negative Positive Negative Positive Negative Positive Negative Positive Male 31 (49.2) 32 (50.8) 0.516 56 (88.9) 7 (11.1) 0.260 44 (69.9) 19 (30.1) 0.233 54 (58.7) 9 (14.3) 0.862 Female 18 (56.2) 14 (43.8) 31 (96.9) 1 (3.1) 26 (81.2) 6 (18.8) 27 (84.4) 5 (15.6) < 16 26 (53.1) 23 (46.9) 0.765 44 (89.8) 5 (10.2) 0.518 35 (71.4) 14 (28.6) 0.606 40 (81.6) 9 (18.4) 0.303 ≥ 16 23 (50) 23 (50) 43 (93.5) 3 (6.5) 35 (76.1) 11 (23.9) 41 (89.1) 5 (10.9) AML 18 (41.9) 25 (58.1) 0.085 41 (95.3) 2 (4.7) 0.286 32 (74.4) 11 (25.6) 0.882 37 (86) 6 (14) 0.845 ALL 31 (59.6) 21 (40.4) 46 (88.5) 6 (11.5) 38 (73.1) 14 (26.9) 44 (84.6) 8 (15.4) Non-complete remission 11 (44) 14 (56) 0.377 23 (92) 2 (8) 0.930 20 (80) 5 (20) 0.403 22 (88) 3 (12) 0.653 Complete remission 38 (54.3) 32 (45.7) 64 (91.4) 6 (8.6) 50 (71.4) 20 (28.6) 59 (84.3) 11 (15.7) Remission 33 (61.1) 21 (38.9) 51 (94.5) 3 (5.5) 0.248 45 (83.3) 9 (16.7) 48 (88.8) 6 (11.2) 0.253 Relapse/Refractory 16 (39) 25 (61) 36 (87.8) 5 (12.2) 25 (61) 16 (39) 33 (80.5) 8 (19.5) No received 39 (59.1) 27 (31.9) 62 (93.9) 4 (6.1) 0.211 54 (81.8) 12 (18.2) 59 (89.4) 7 (10.6) 0.087 Received 10 (34.5) 19 (65.5) 25 (86.2) 4 (13.8) 16 (55.2) 13 (44.8) 22 (75.9) 7 (24.1) Death 7 (41.2) 10 (58.8) 0.344 15 (88.2) 2 (11.8) 0.631 12 (70.6) 5 (29.4) 0.749 15 (88.2) 2 (11.8) 0.703 Alive 42 (53.8) 36 (46.2) 72 (92.3) 6 (7.7) 58 (74.4) 20 (25.6) 66 (84.6) 12 (15.4) CMV infection – – – 43 (93.5) 3 (6.5) 0.716 27 (58.7) 19 (41.3) 38 (82.6) 8 (17.4) 0.479 EBV infection 5 (62.5) 3 (37.5) 0.518 – – 5 (62.5) 3 (37.5) 0.430 5 (62.5) 3 (37.5) 0.092 HHV-6 infection 6 (24) 19 (76) 22 (88) 3 (12) 0.430 – – – 22 (88) 3 (12) 0.754 HHV-7 infection 6 (42.8) 8 (57.2) 0.479 11 (78.6) 3 (21.4) 0.092 11 (78.6) 3 (21.4) 0.754 – – – HHV-6 infection 1.436 4.205 1.450–12.198 Salvage received 1.060 2.887 1.048–7.955 CMV infection 1.450 4.265 1.474–12.345
Univariate logistic regression analysis of risk factors for HHVs (EBV, CMV, HHV-6 and HHV-7) infections were performed, showing the association between viral infections and patient's demographic and clinical characteristics using the Chi-square (X
When comparing infections involving only single herpes viral infection with infections involving herpes viral co-infection, no statistically significant differences were observed with respect to age groups (< 16 and ≥ 16 years), type of leukemia, disease status and therapy phase. However, male gender was significantly higher in viral co-infection compared with single infection (p = 0.007). Detections involving herpes viral co-infections were associated with higher rates of mortality compared with a single viral infections, with borderline significance (p = 0.058), but this finding was not time-related. Table 5 shows that the presence of severe lymphopenia (ALC < 500/μL) was significantly higher in co-infections compared with mono-viral infections (p < 0.001). Herpes viral co-infection group compared with only single herpes viral infection group had more often rash, pneumonia, bacteremia and fungal co-infection (p = 0.04, p = 0.008, p < 0.001, p = 0.038, respectively).
Relation between demographic and clinical characteristics of patients with mono-viral infection and viral co-infection
Variables Active viral infection ( No. (%) Active mono-viral infection ( No. (%) Active viral co-infection ( No. (%) Male 54 (64.3) 34 (55.7) 20 (86.9) Female 30 (35.7) 27 (44.3) 3 (13) < 16 49(58.3) 37 (60.7) 12 (52.2) 0.482 ≥ 16 35 (41.7) 24 (39.3) 11 (47.8) AML 36 (42.9) 25 (41) 11 (47.8) 0.572 ALL 48 (57.1) 36 (59) 12 (52.2) Newly diagnosed 9 (10.7) 7 (11.5) 2 (8.7) 0.443 Remission 54 (64.3) 41 (67.2) 13 (56.5) Refractory or relapse 21 (25) 13 (21.3) 8 (34.8) Before chemotherapy 9 (10.7) 7 (11.5) 2 (8.7) 0.607 Post-induction 21 (25) 13 (21.3) 8 (34.8) Post-remission 28 (33.3) 22 (36) 6 (26.1) Post-salvage 26 (31) 19 (31.1) 7 (30.4) Alive 72 (85.7) 55 (90.2) 17 (74) 0.058 Dead 12 (14.3) 6 (9.8) 6 (26) 56 (66.6) 41 (67.2) 15 (65.2) 0.863 48 (57.2) 32 (52.5) 16 (69.5) 0.158 38 (45.3) 27 (44.3) 11 (47.8) 0.209 45 (53.5) 25 (41) 20 (87) 28 (33.3) 20 (32.8) 8 (43.8) 1.000 29 (34.5) 21 (34.4) 8 (43.8)) 0.986 17 (20.2) 8 (13.1) 9 (39.1) 5 (6) 3 (5) 2 (8.7) 0.514 17 (20) 8 (13.1) 9 (39) 10 (11.9) 7 (11.5) 3 (13) 0.843 12 (14.3) 7 (11.5) 5 (21.7) 0.231 2 (2.4) 0 (0) 2 (8.7) – 7 (8.3) 3 (5) 4 (17.4) 0.065 16 (19) 6 (9.8) 10 (43.5) 14 (16.6) 7 (11.5) 7 (30.4)
Viral infections were divided into two groups based on the number of viruses detected: active mono-viral infections and co-infections Severe neutropenia [ANC < 500/μL]; Prolonged neutropenia [if it persisted over 7 days]; Severe lymphopenia [ALC < 500/μL]; Anemia [hemoglobin < 11 g/L], Thrombocytopenia [platelet count < 100 10
The detailed relationship between CMV mono-viral infection and CMV co-infection and clinicopathological parameters are presented in Table 6.
Relation between demographic and clinical characteristics of patients with CMV mono-viral infection and CMV viral co-infection
Variables No active CMV infection ( No. (%) Active CMV mono-infection ( No. (%) Active CMV co-infection ( No. (%) Sex 15 (57.7) 23 (59) 16 (84.2) 0.119 11 (42.3) 16 (41) 3 (15.8) < 16 17 (65.4) 22 (56.4) 10 (52.6) 0.655 ≥ 16 9 (34.6) 17 (43.6) 9 (47.4) AML 6 (23) 21 (53.8) 9 (47.4) ALL 20 (76.9) 18 (46.2) 10 (52.6) Newly diagnosed 1 (4) 6 (15.4) 2 (10.5) 0.342 Remission 20 (76.9) 24 (61.5) 10 (52.6) Refractory or relapse 5 (19.1) 9 (23) 7 (36.8) Before chemotherapy 1 (3.8) 6 (15.4) 2 (10.5) 0.802 Post-induction 7 (26.9) 10 (25.7) 4 (21) Post-remission 8 (30.8) 13 (33.3) 7 (36.8) Post-salvage chemotherapy 10 (38.5) 10 (25.6) 6 (31.6) Alive 24 (92.3) 34 (87.2) 14 (73.7) 0.198 Dead 2 (7.7) 5 (12.8) 5 (26.3) 16 (61.5) 28 (71.8) 12 (63.1) 0.646 11 (42.3) 24 (61.5) 13 (68.4) 0.163 8 (30.8) 20 (51.3) 10 (52.6) 0.752 11 (42.3) 18 (46.2) 16 (84.2) 7 (26.9) 15 (38.5) 6 (31.6) 0.507 7 (26.9) 16 (41) 6 (31.6) 0.364 2 (7.7) 6 (15.4) 8 (42.1) 1 (3.8) 2 (5.2) 2 (10.5) – 2 (7.7) 7 (17.9) 8 (42.1) – 7 (17.9) 3 (15.8) 0.084 2 (7.7) 5 (12.8) 5 (26.3) 0.198 – 2 (5.2) – – 1 (3.8) 2 (5.2) 4 (21) 0.073 4 (15.4) 4 (10.3) 8 (42.1) 2 (7.7) 5 (12.8) 7 (36.8)
Viral infections were divided into three groups (
No active CMV infection, Active CMV mono-viral infection and active CMV co-infection groups had common characteristics including age groups, status of disease, and phase of therapy. However, no active CMV infection group was more often treated for acute lymphoblastic leukemia (ALL) compared to single CMV infection (p = 0.044). The presence of active CMV co-infection was more associated with high-risk clinical parameters including severe lymphopenia (p = 0.009), rash (p = 0.011), pneumonia (p = 0.016), bacteremia (p = 0.013) and fungal infection (p = 0.024) than with patients with active CMV mono-viral infection.
There have been limited studies on herpes viral infection in non-transplant acute leukemia patients undergoing chemotherapy and the majority of them have focused on CMV, with very little regard for other HHVs. The current study aimed, therefore, to investigate the frequency of six HHVs at different phases of chemotherapy and to identify their possible interactions during co-infections. We also studied the potential risk factors for viral infections and their impact on the clinical outcome during coexistence.
In contrast to developed countries, where HHVs seroprevalence and occurrence are well documented, there is only scarce information available in Tunisia [[
The DNA detection of CMV, HHV-6, HHV-7 and EBV were 19.4, 9.7, 5.2 and 2.7% respectively. The data concerning HHVs infections observed in literature are very heterogeneous in the non-transplant setting. The rate of CMV infection or recurrence varied from 2 to 67% among reported patients with hematological malignancies receiving non-transplant treatment [[
Discrepancies among these studies could be attributed to several reasons including differences in methodology, clinical and epidemiological characteristics, frequency of virological monitoring, type of specimen and the wide spectrum of technique sensitivity.
Our data showed that HHVs detections were higher after induction, after post-remission, and at salvage chemotherapy than before chemotherapy confirming the recurrence of these viruses after chemotherapy. This seems to be related to specific defects of immune function detectable at diagnosis of leukemia and arising during treatment [[
Our results showed that HHVs infections did not seem to confer protection against chemoresistance and hematologic disease relapse. It was found in our study that the high incidence of CMV and HHV-6 viral infection occurred during post-remission but also this risk increases further with relapse of disease, consistent with other previous studies [[
This study allowed us to recognize multiple infections in 28.4% (27/95) of acute leukemia patients. The majority of the multiple infected patients had co-infections (23/27). Sixteen patients had combined CMV-HHV6 infections. Both active infections were significantly associated (p < 0.001) which is consistent with previous studies examining the relationships and the effects of HHV combinations, particularly in the context of solid organ transplant SOT recipients. β-HHVs were found to transactivated each other; while CMV infection appeared to trigger HHV-6 and/or HHV-7 co-infection and vice versa [[
Based on these results, the time of CMV activation could be predicted based on the timing of HHV-6 infection. HHV-6 is known to have immunomodulatory and immunosuppressive effects that could predispose patients to CMV reactivation/infection [[
In this work, the highest frequencies of viral co-infections were found in men although the specific reasons underlying this effect remains unknown. Several studies have shown that behavioral factors and physiological differences between males and females cause dimorphic responses to infection. The intensity and prevalence of viral infections were found to be higher in males, whereas females typically display reduced susceptibility to viral infections because they often mount stronger immune responses than males [[
According to our study, herpes viral co-infection showed a more significant association with profound lymphopenia (ALC < 500/μL), pneumonia, opportunistic infections (bacteremia and invasive fungal infection) than with single infection and a borderline association with increased risk of death. Diseases that cause lymphopenia are typically associated with an increased predisposition to various infections, either directly as a result of the lymphopenia-associated immune suppression or because of the underlying disease. There seems to be a strong relationship between the degree of lymphopenia and the acquisition of multiple opportunistic infections. Similar findings were reported in SOT settings, where pre- or post-transplant ALC, as well as specific lymphocyte subsets, were associated with the development of opportunistic infections following transplantation [[
This study showed that HHVs infections were high in acute leukemia patients who were receiving chemotherapy. We demonstrated the presence and the possible clinical relevance of HHVs coinfections. CMV/HHV6 co-infections were the most frequent co-infections. The clinical outcome of HHVs co-infection was more severe in HHVs single infection which suggests that viruses were frequently involved in the complications after chemotherapy. Future prospective studies in larger acute leukemia cohorts should be performed to better clarify the spectrum of these viral infections, to define the mechanism underlying the potential evidence of viral cooperation and to determine if prevention or treatment of reactivating viruses leads to improve outcomes.
This work was funded by the Ministry of Higher Education and Scientific Research, Tunisia. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Not applicable.
Not applicable.
IH, NH, AK and JB contributed to the conception and design of research. IH, BA, MM, SR, OH acquired data in the study. IH performed the experiments. IH, BA, MM, SR, OH, IB and NH participated in the analysis and interpretation of data. IH and NH wrote the draft manuscript. AK, NH and JB supervised and supported the study. All authors read and approved the final manuscript.
Data are available from the corresponding author on reasonable request.
The study was approved by the ethics committee and medical research of the Farhat Hached University Hospital, Sousse, Tunisia (Reference number IRB00008931). Written informed consent was obtained from the patients or the guardians of the patients participated in this research.
The authors declare that they have no competing.
Graph: Additional file 1: Figure S1. Specificity of herpesviruses multiplex PCR. Agarose gel electrophoresis of herpesviruses multiplex PCR showed that a unique PCR product of the expected size was amplified in each positive control. MM: 100pb (base pairs) molecular weight marker and Negative Control (No band).
• ALC
- Absolute lymphocyte count
• ALL
- Acute lymphoblastic leukemia
- allo-HSCT
- Allogeneic hematopoietic stem cell transplant
• AML
- Acute myeloid leukemia
• ANC
- Absolute neutrophil count
• CMV
- Cytomegalovirus
• CR
- Complete remission
• EBV
- Epstein-Barr virus
• HHV-6
- Human herpesvirus 6
• HHV-7
- Human herpesvirus 7
• HHV-8
- Human herpesvirus 8
• HHVs
- Human herpesviruses
• HSV
- Herpes simplex virus
• IFI
- Indirect immunofluorescent techniques
• IgG
- Immunoglobulin G
• IgM
- Immunoglobulin M
• OR
- Odds ratio
• PCR
- Polymerase Chain Reaction
• SOT
- solid organ transplant
• VZV
- Varicella -zoster virus
- α-HHVs
- Alpha-human herpesviruses
- β-HHVs
- Beta-human herpesviruses
- γ-HHVs
- Gamma- human herpesviruses
Supplementary information accompanies this paper at 10.1186/s12985-020-01302-4.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Imene Handous; Bechir Achour; Manel Marzouk; Sana Rouis; Olfa Hazgui; Ines Brini; Abderrahim Khelif; Naila Hannachi and Jalel Boukadida
Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author