Role of CFH Y402H and ARMS2 A69S polymorphisms in susceptibility to post rhegmatogenous retinal detachment macular complications.

Rhegmatogenous retinal detachment (RRD) is the most common type of retinal detachment. Purpose of this study is to evaluate the possible association of ARMS2 (age-related macular susceptibility 2) A69S and CFH (complement factor H) Y402H polymorphisms with post-surgical macular complications. One hundred and two RRD patients with macular involvement and proliferative vitreoretinopathy grade A prospectively were enrolled in the study. All patients were genotyped for two polymorphisms of CFH Y402H and ARMS2 A69S by applying Polymerase Chain Reaction (PCR)—Restriction Fragment Length Polymorphism (RFLP). Scleral buckling or deep vitrectomy performed based on surgeon decision. Optical coherence tomography (OCT) for all patients was performed on three, six, and twelve months after operation. The ARMS2 A69S GT genotype showed significant association with postoperative cystoid macular edema (OR = 3.11, P = 0.039). Logistic regression analysis showed that the effect of ARMS2 GT vs GG genotype remained significant on CME after confounding factors correction. (ARMS2 GT vs GG OR = 4.79, p value = 0.035). No association was observed between studied genotypes and postoperative persistent subfoveal fluid, macular atrophy, and macular epiretinal membrane. The ARMS2 A69S GT genotype was significantly associated with postoperative cystoid macular edema in RRD cases with macular involvement.

Keywords: CFH Y402H; ARMS2 A69S; rhegmatogenous retinal detachment; cystoid macular edema

Retinal detachment (RD) is one of the most common causes of blindness in which the neurosensory retina is separated from the underlying retinal pigment epithelium (RPE) causing accumulation of the fluid in this space ([1],[2]). Retinal detachment makes the neurosensory retina deprived of nutrients and oxygen resulting in severe visual disruption. The retinal detachment has three main types: rhegmatogenous (RRD), tractional (TRD), and exudative (ERD)([1]). In rhegmatogenous RD, formation of a break in the retina causes the egress of fluid from the vitreous cavity into the sub-retinal space, which separates retina from the underlying RPE layer. RRD incidence is higher among elderly patients ([3]) and this disease is observed with more frequency among men([4]). High myopia, lattice retinal degeneration, trauma, previous cataract surgery, inflammation, and some heritable syndromes are known risk factors for RRD ([5],[6]). Familial aggregation studies and evaluation of monogenic conditions associated with RRD have suggested involvement of genetic factors in its development ([7],[8]). Several studies in animal models have shown active role of inflammatory agents in the detached retina ([[9], [11]]). An animal model study has also shown up-regulation of genes involved in complement pathway in RD([12]). This study reported early activation of complement components genes in the detached and peri-detached retina. Two genes involved in the activation of complement pathway are ARMS2 A69S (age-related macular susceptibility 2, probable activator of complement system) and CFH Y402H (complement factor H) gene (major inhibitor of complement alternative pathway). Several studies have previously demonstrated significant associations of the ARMS2 A69S and CFHY402H coding variants with retinal diseases such as age-related macular degeneration ([13],[14]).

A local inflammatory reaction has been shown as a reactive change in the retina after detachment even in the attached part of the retina([12]). The purpose of this study was to evaluate the possible role of CFH Y402H and ARMS2 A69S polymorphisms in RRD related post-operative complication. We decided to evaluate role of these genetic loci in postoperative cystoid macular edema, macular atrophy, macular epiretinal membrane, and persistent subfoveal fluid.

In this prospective study, we genetically assessed the polymorphic regions of rs10490924 in ARMS2 gene and rs1061170 in CFH gene among 102 RRD patients. RRD was diagnosed based on a definition of a full thickness break in the neurosensory retina with a surrounding area of sub-retinal fluid extending greater than two disc diameters([15]). All other types of retinal detachment (exudative, tractional and combined) were excluded. RRD cases secondary to complicated cataract surgery or giant retinal tear and macula on cases were also excluded. Participants with a cataract surgery within 2 years of the detachment diagnosis or with known syndromic disease were excluded. RRD cases with proliferative vitreoretinopathy grade of greater than A were also excluded. All cases were followed-up for at least 12 months in order to evaluate the possible post-operative complications. The study was approved by ethics committee of Tabriz University of Medical Sciences and informed consent was signed by all participants. All patients underwent detailed regular ophthalmic examination and macular optical coherence tomography (OCT spectral domain, Heidelberg Engineering Inc) was also performed 3, 6, and 12 months after operation. Scleral buckling or 23 gauge parsplana deep vitrectomy surgery (with silicon oil or SF6 gas injection) performed based on surgeon decision for patients. For none of the patients cryoretinopexy was used during surgery. Silicon oil removal was done three months after vitrectomy and we documented postoperative complications including long standing sub-foveal fluid remaining more than 3 months after operation, CME (cystic macular edema), macular atrophy or epiretinal membrane (ERM).

To evaluate the possible association between these genes and post-operative complications, DNA was extracted from peripheral blood samples using deoxyribonucleic acid (DNA) extraction standard protocol (saturated salt). Each extracted DNA sample was subjected to Polymerase Chain Reaction (PCR) followed by Restriction Fragment Length Polymorphism (RFLP) to genotype for A69S and Y402H polymorphism. Primer sequences of CFH have been reported previously([14]). ARMS2 primers which we used were: F:5ʹATACCCAGGACCGATGGTAAC3' and R:5ʹAGAGGAAGGCTGAATTGCCTA3'. The PCR reaction was initiated by an early denaturation at 95°C for 5 min about both of genes followed by 30 continued cycles of denaturation at 95°C for 30s, annealing at 58.1°C for ARMS2 gene(45s) and 59.5°C for CFH gene(45s), and extension at 72 °Ct for 45s. Fragments of 450 bp for ARMS2 and of 179 bp for CFH were amplified. Then PvuII and TSP509I (TasI) restriction enzymes were used respectively to digest the amplified products of ARMS2 and CFH genes. For enzyme digestion of the PCR products, specific enzyme buffer, enzyme and ddH2O were subjected at 37°C overnight. The results of enzyme digestion for ARMS2 gene were separable on 1.5% agarose gel. PvuII enzyme digests when there is G allele (wild allele) creating two fragments of 257 base pair (bp) and 193bp. Therefore, a single fragment of TT genotype (450bp) and three fragments of GT genotype (450,257and193bp) would be displayed on the agarose gel. We identified genotypes of obtained fragments of enzyme digestion for CFH gene on 10% polyacrylamide gel electrophoresis. TSP509I enzyme digests when there is T allele (wild allele) which creates two fragments of 119bp and 60bp. Therefore, a single fragment of CC genotype (179bp) and three fragments of CT genotype (179,119 and 60bp) would be displayed on the polyacrylamide gel. Ten numbers of PCR products were subjected to sanger sequencing to confirm the obtained results of PCR-RFLP.

Statistical analysis was performed using SPSS software statistics 16. The OR (odds ratio) and CI (confidence interval) were calculated. We applied Chi-Square test to assess the differences between groups. Chi-Square test also used to evaluate Hardy Weinberg equilibrium (HWE). To compare visual difference between groups of patients with and without CME, ERM, and macular atrophy we used independent t test. There was statistically significant difference between case and control when P-values < 0.05. For correcting the confounding variables, we used logistic regression analysis. The model included the CME, SRF, ERM and macular atrophy as dependent variables and ARMS2 or CFH as independent variables. Effects of age, gender, lens status, type of tamponade used (gas vs silicon oil), surgery types (scleral buckle vs vitrectomy) and redetachment considered as confounding factors.

One hundred and two RRD patients with macular involvement were included in this study. Mean age in patients was 52.6 ± 13.6 years. We have sixty-six male and 36 female cases. Fifty-four patients were phakic and 48 of patients were pseudophakic. ARMS2 genotypes in our cases were consistent with Hardy Weinberg equilibrium (HWE). Scleral buckling surgery performed for 34 cases and vitrectomy surgery performed for 68 cases. We have 68 cases with horseshoe tear related RRD and 34 cases with atrophic hole/lattice degeneration. We have six cases of redetachment during follow-up period who were undergone reoperation and all remained attached thereafter. Eight eyes of eight patients have postsurgical intraocular pressure rise which was controlled with topical beta blocker.

Seventeen of our RRD patients developed CME (cystoid macular edema), twelve cases had macular ERM (epiretinal membrane), seven cases had persistent SRF (subretinal fluid) and nine patients developed macular atrophy postoperatively. Patients with CME, ERM and macular atrophy had visual decrease during follow-up period after initial surgical response. (mean LogMar (logarithm of minimum angle of resolution) comparison: atrophy vs non-atrophy 1.39 ± 0.27 vs 0.78 ± 0.29 p value <0.05, CME vs non-CME 1.19 ± 0.17 vs 0.76 ± 0.32 p value <0.05 and ERM vs Non-ERM 1.26 ± 0.14 vs 0.78 ± 0.31 p value <0.05).

ARMS2 A69S GT genotype showed significant association with postoperative CME (OR = 3.11, 95% CI 1.10–9.53, P = 0.039). None of the studied genotypes were associated with other postoperative complications such as macular atrophy, macular ERM or persistent SRF. (Tables 1–2) Logistic regression test showed that the effect of ARMS2 GT vs GG remained significant on CME after confounding factor correction. (ARMS2 GT vs GG OR = 4.79 95% CI 1.11–20.68, p value = 0.035).

Table 1. ARMS2 A69S Genotype distribution among RRD patients with and without different post-operative complications.

1 OR: Odds ratio

2 CI: confidence interval

Table 2. CFH Y402H Genotype distribution among RRD patients with and without different post-operative complications.

• 3 OR: Odds ratio
• 4 CI: confidence interval

Our findings showed that ARMS2 A69S GT genotype has significant association with postoperative cystoid macular edema. RRD is a major cause of visual impairment. Although the only effective treatment modality of this disease is surgery, even successful operation fails to restore the normal visual capabilities because of functional alterations in the retina. Multiple inflammatory pathways have been shown to be activated after retinal detachment ([9],[16]). Another study has shown early activation of inflammatory genes such as complement components genes in retinal detachment([12]). This genetic expression alteration was also observed in the non-detached retina as well as in the underlying RPE layer([12]).

In this study we selected ARMS2 A69S and CFH Y402H as inflammatory polymorphic genetic loci to evaluate their possible role in post-operative complication. ARMS2 (age-related maculopathy susceptibility) locus, originally named LOC387715, is located on Chromosome 10q26. Some have demonstrated a mitochondrial association of the ARMS2 protein and defined its retinal localization to the ellipsoid region of the photoreceptors([17]). Others have reported its localization in the cytosol or extracellular matrix. ([18],[19]) ARMS2ʹs role in the pro-inflammatory pathway has been shown by some authors ([13],[20],[21]). CFH Y402H (rs1061170) is located on Chromosome 1q32. Its polymorphism results in T to C change in exon 9 which causes tyrosine (Y) to histidine (H) exchange at position 402. CFH has an inhibitory effect on the alternative complement cascade and its polymorphism causes complement activation. The CFH Y402H polymorphism has been shown to increase the inflammatory milieu in the RPE/sub-retinal space ([22],[23]). It has been suggested that ARMS2 and CFH Y402H genes have common pathway of effect in AMD pathogenesis([13]).

Post-operative macular changes is a significant cause of permanent visual deficit in RRD cases. Elucidation of genetic background which makes patients susceptible to these complications may pave the road for future therapeutic or preventive options. In this study we selected these two genetic loci as important inflammatory and complement related loci in retina to evaluate their possible role in post RRD macular changes. We found that among studied post-surgical RRD complications, CME is associated with ARMS2 A69S GT risk genotype. We found no association of other complications such as macular atrophy, macular ERM or persistent SRF with CFH Y402H or ARMS2 A69S genotypes.

It has already been shown that these genetic loci specially ARMS2/LOC387715 A69S are strongly associated with supra-RPE (retinal pigment epithelium) AMD subtypes such as reticular pseudodrusen (RPD) and retinal angiomatous proliferation (RAP) ([24],[25]). In accordance with that, our present findings show that among those post-surgical complications in RRD cases with macular involvement, CME is strongly associated with ARMS2 GT genotype. It seems that RRD and its surgery in genetically susceptible patients could initiate inflammatory process which may end in cystoid macular edema.

Relatively small number of cases is the main limitation of this study. Future large sample sized studies could clearly explain the role of these genetic loci in susceptibility to post RRD macular complications.

We specially appreciate all who have participated in this study.

No potential conflict of interest was reported by the author(s).

Data available within the article or its supplementary materials.