Background: High cost of commercial RNA extraction kits limits the testing efficiency of SARS-CoV-2. Here, we developed a simple nucleic acid extraction method for the detection of SARS-CoV-2 directly from nasopharyngeal swab samples. Methods: A pH sensitive dye was used as the end point detection method. The obvious colour changes between positive and negative reactions eliminates the need of other equipment. Results: Clinical testing using 260 samples showed 92.7% sensitivity (95% CI 87.3–96.3%) and 93.6% specificity (95% CI 87.3–97.4%) of RT-LAMP. Conclusions: The simple RNA extraction method minimizes the need for any extensive laboratory set-up. We suggest combining this simple nucleic acid extraction method and RT-LAMP technology as the point-of care diagnostic tool.
Keywords: Diagnosis; RT-LAMP; SARS-CoV-2; Phenol red; pH sensitive indicator
Supplementary Information The online version contains supplementary material available at https://doi.org/10.1186/s12879-022-07684-w.
Coronavirus disease 2019 (COVID-19), caused by the most recently discovered coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has hit the whole world since December 2019. Mass testing and identification of infected individuals are of utmost importance in the ongoing COVID-19 pandemic. Easy and rapid laboratory diagnosis are needed to control this pandemic. This study aims to simplify the current method used to diagnose COVID-19 as well as suggest better sample collection and RNA extraction methods. At present, real-time reverse transcription polymerase chain reaction (RT-qPCR) method remains the gold standard and most reliable detection method to detect the virus. However, PCR-based detection method is laborious, expensive, and time consuming as it requires special instruments, supply-limited reagents, and well-trained personnel [[
Here, we used a modified Chelex 100 Resin concentration method coupled with RT-LAMP colorimetric test on nasopharyngeal swab samples in viral transport media (VTM) by amplifying the N gene which codes the nucleocapsid region of SARS-CoV-2. The RNA was extracted using chelating resin without a further purification step. The extracted RNA served as a template for the RT-LAMP assay. Phenol red, a pH sensitive colorimetric dye was used as the colour indicator [[
Hospital Sungai Buloh (HSB) and Institute for Medical Research (IMR), Malaysia, provided a total of 260 fresh nasopharyngeal swab samples, in 250 µL of VTM (Additional file 1: Table S1). Prior to that, the swab samples were heat-inactivated at 65 °C for 1 h. Of 260 samples, 150 samples were confirmed positive for SARS-CoV-2 (HSB, n = 60 and IMR, n = 90) by RT-qPCR with Ct value range from 12.71 to 38.80, while 110 samples were reported negative (HSB, n = 50 and IMR, n = 60). The RNA extraction kit and RT-qPCR kit involved in this study were QIAamp Viral RNA Mini Kit (Hilden, Germany) and SuperScript™ III Platinum™ One-Step qRT-PCR Kit (Thermo Fisher Scientific, Massachusetts, United States), respectively. This study was approved by UMMC Medical Ethics Committee (202041-8418) and Malaysian Ministry of Health Medical Research Ethics Committee (MREC) (NMRR-20-2344-56994).
RNA extraction was carried out by using Chelex 100 Resin extraction protocol adopted from Janíková et al. and Perez et al. with minor modifications [[
The extracted RNAs were amplified using nucleocapsid (N) gene, targeting on N1 region. Primer-Explorer V4 software (Eiken Chemical Co., Ltd., Tokyo, Japan) was used to design the primers (Table 1) and it has been reported previously [[
Table 1 Primers used in this study
Primer Sequence (5ʹ to 3ʹ) FIP TGGGGTCCATTATCAGACATTTTAGTTTTAGAGTATCATGACGTTCG BIP CGAAATGCACCCCGCATTACCCACTGCGTTCTCCATTC FLP TGTTCGTTTAGATGAAATC BLP TGGTGGACCCTCAGATTCAA F3 GTTGTTCGTTCTATGAAGACT B3 GACGTTGTTTTGATCGCG
Features: FIP: Forward inner primer; BIP: backward inner primer; FLP: forward loop primer; BLP: backward loop primer; F3: forward primer; B3: backward primer
Graph: Fig. 1 Visualization of the RT-LAMP with the colour change of phenol red from pink (negative) to yellow (positive). Tube 1: Positive reaction; Tube 2: Negative reaction
To test the analytical sensitivity of the phenol red RT-LAMP assay, a recombinant plasmid carrying the N gene was constructed. F3 and B3 primers were used to amplify the N gene from a synthetic fragment (Sangon Biotec Co., Ltd., Shanghai, China). PCR conditions were as follows: denaturation at 94 °C for 3 min, 30 cycles at 94 °C for 30 s, at 55 °C for 30 s, and at 72 °C for 30 min, and a final extension step at 72 °C for 10 min. The PCR product was then subjected to 1.5% agarose gel electrophoresis. The amplified gene fragment was purified prior to cloning into the pGEM-T vector (Promega Corporation, Madison, WI) and transformed into TOP10F' Escherichia coli competent cells. Recombinant plasmids were extracted using the Qiagen Spin Miniprep kit (Qiagen, Hilden, Germany) and were sent to Apical Scientific SDN BHD (Kuala Lumpur, Malaysia) for sequencing to confirm their identity. The pGEM-T vector containing the N insert was linearized by BamHI and transcribed to RNA using RiboMAX™ Large Scale RNA Production Systems (Promega Corporation, Madison, WI) according to the manufacturer's instructions. The RNA copy number was calculated based on the following formula: copies/µL = 6.02 × 10
Analytical specificity test was performed by using other respiratory viruses such as Adenovirus 4, Coronavirus, Influenza A H3, Influenza B, Novel influenza A H1N1, Parainfluenza 1, Parainfluenza 2, Parainfluenza 3, RSV (subtype A), RSV (subtype B) (AMPLIRUN
Clinical sensitivity was evaluated using the formula: (number of true positives)/(number of true positives + number of false negatives), while specificity was calculated as (number of true negatives)/(number of true negatives + number of false positives).
Analytical sensitivity test of N gene for phenol red RT-LAMP was 1 copy/µL RNA. None of the other viruses were detected by the RT-LAMP assay. By using 260 sample here, the clinical sensitivity and specificity of RT-LAMP assay were calculated. We found that most of the RT-PCR positive samples with a Ct < 30 changed colour within the first 20 min of the reaction. Samples with Ct > 30 either took a longer time for the colour to change or there were no changes colour at all. RT-LAMP shows 92.7% sensitivity (95% CI 87.3–96.3%) and 93.6% specificity (95% CI 87.3–97.4%), respectively.
The high cost of currently available commercial RNA extraction kits has impeded mass testing of Covid-19. Therefore, we decided to develop a novel nucleic acid extraction method for SARS-CoV-2 from nasopharyngeal swab samples. Without the use of high throughput equipment, a total of 260 samples were extracted and used as the template for the RT-LAMP assay. We managed to achieve 92.7% sensitivity and 93.6% specificity for RT-LAMP. This extraction method is easy to perform and could be scalable according to the sample size, thereby enabling it to be adopted in both clinical laboratories and field settings. Our newly developed RNA extraction method is much cheaper (USD$2.27/reaction) compared to a commercial QIAamp Viral RNA Mini kit (USD$6.45/reaction). In terms of speed, Chelex extraction method is more rapid (~ 16 min) than the conventional extraction kit (~ 40 min). Also, the commercially available phenol red LAMP mix is costly. For example, WarmStart
Out of 260 samples tested, results show that RT-LAMP did not detect 11 RT-PCR positive samples. This potentially happened because the viral load of the sample was too low (RT-PCR Ct > 30) and degraded during delivery to our laboratories. These 11 samples were not detected by RT-PCR and RT-LAMP after re-extraction using commercial kit in our laboratories. As mentioned by Azmi et al., SARS-CoV-2 diagnostics is especially challenging during the RNA extraction step, and samples are is often at risk of degradation during delivery [[
In comparison to our previous study [[
Chelex extraction methods on SARS-CoV-2 have been presented by several groups of researchers previously. However, with minor modifications to the previous presented method by Janíková et al. and Perez et al., the sensitivity of RT-LAMP assay developed here (92.7%) was higher [[
As for Anathar et al., they reported a direct RT-LAMP assay by using specimens that were either added directly to the reactions, inactivated by a combined chemical and heat treatment step, or inactivated followed by purification with a silica particle-based concentration method. However, we were not able to replicate these methods after several trials. The failure may be due to the different types of VTM being used and presence of inhibitors such as glucose in VTM [[
We found that increasing incubation time for samples with Ct > 30 was not helpful as nonspecific amplification may occur. This finding was similar as reported by Dao Thi et al. [[
We chose a pH dye indicator as the end point detection method as phenol red is cheap and non-toxic for visual detection. Moreover, the colour changes between positive and negative reaction are obvious, and the colour change can be visualized with the naked eye. The distinct colour changes would be useful for people working in the diagnostics field to interpret the COVID-19 results accurately without additional assistance and special equipment. Hence, phenol red has gained popularity among investigators around the world in the development of a diagnostic tool for SARS-CoV-2 [[
Since phenol red is sensitive to pH changes, the in-house prepared 10× low strength buffer is strongly suggested to be prepared in small aliquots and stored at − 20 °C. It is not recommended to freeze–thaw the buffer too many times to avoid pH changes. Also, RNA was suggested to be eluted in Tris-ethylenediaminetetraacetic acid (TE) buffer pH 8 instead of double distilled water as double distilled water may adsorb carbon dioxide from atmosphere, causing the pH of the water to become slightly acidic. Because of pH buffer changes, false positives may occur.
To enhance the performance of RT-LAMP assay, GuHCl was added. As recommended by Zhang et al., 40 mM of GuHCl was added into the reaction mixture [[
For cost/reaction, the RT-LAMP assay combined with Chelex extraction method presented here was way cheaper than commercially RT-LAMP kit and RNA extraction kit. The total cost (Chelex extraction method and custom make LAMP buffer) was USD$4.20/reaction. Meanwhile, the total cost of commercially available LAMP kit such as WarmStart
We present a simple RNA extraction procedure from nasopharyngeal swab samples here. By additional of pH indicator dye and additive into the RT-LAMP assay, we managed to develop a rapid, cost effectively and simple-to-interpret assay for the detection of SARS-CoV-2. Therefore, this RT-LAMP assay is speculated to be deployed for mass screening applications in local and referral laboratories.
We would like to thank the Director General of Health Malaysia for his permission to publish this article.
MYL, FDMB and NZZ wrote the manuscript and contributed in study design. II, NIM, TSTS, AHH, KMP, YLL, JS, RT, MKMI and NZAW collected the data and confirmed the patient's diagnosis. MYL and YLL analyzed the data. All authors read and approved the final manuscript.
This study was supported by Prototype Research Grant Scheme (PRGS), PR001-2020B (PRGS/2/2020/SKK09/UM/02/1) from the Ministry of Education, Malaysia.
All relevant data are within the paper or Additional file 1. The information of cloned N gene is available at https://
Ethics approval and consent for participation Informed consent forms were obtained from all study participants. Informed consent forms were obtained from all study participants. This study was approved by University Malaya Medical Centre (UMMC) Medical Ethics Committee (202041-8418) and Medical Research Ethics Committee (MREC) Ministry of Health Malaysia (NMRR-20-2344-56994). All methods and informed consent process were performed in accordance with the relevant guidelines and regulations by Medical Research and Ethics Committee Ministry of Health Malaysia.
Not applicable.
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this manuscript.
Graph: Additional file 1. Result of RT-qPCR and RT-LAMP for 260 samples.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Meng Yee Lai; Fatma Diyana Mohd Bukhari; Nur Zulaikha Zulkefli; Ilyiana Ismail; Nur Izati Mustapa; Tuan Suhaila Tuan Soh; Afifah Haji Hassan; Kalaiarasu M. Peariasamy; Yee Leng Lee; Jeyanthi Suppiah; Ravindran Thayan; Mohd Khairi Mat Isa; Nur Zafirah Abdul Wahid and Yee Ling Lau
Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author