CUL4B, a crucial scaffolding protein in the largest E3 ubiquitin ligase complex CRL4B, is involved in a broad range of physiological and pathological processes. While previous research has shown that CUL4B participates in maintaining intestinal homeostasis and function, its involvement in facilitating intestinal recovery following ionizing radiation (IR) damage has not been fully elucidated. Here, we utilized in vivo and in vitro models to decipher the role of CUL4B in intestinal repair after IR-injury. Our findings demonstrated that prior to radiation exposure, CUL4B inhibited the ubiquitination modification of PSME3, which led to the accumulation of PSME3 and subsequent negative regulation of p53-mediated apoptosis. In contrast, after radiation, CUL4B dissociated from PSME3 and translocated into the nucleus at phosphorylated histones H2A (γH2AX) foci, thereby impeding DNA damage repair and augmenting p53-mediated apoptosis through inhibition of BRCA1 phosphorylation and RAD51. Our study elucidated the dynamic role of CUL4B in the repair of radiation-induced intestinal damage and uncovered novel molecular mechanisms underlying the repair process, suggesting a potential therapeutic strategy of intestinal damage after radiation therapy for cancers.
Keywords: CUL4B; Ionizing radiation; Intestinal injury-regeneration; p53-mediated apoptosis
The toxicity of ionizing radiation (IR) is usually associated with chronic and acute radiation syndromes that occur following exposure to IR, resulting in damage to a wide range of organs such as the stomach and intestine. In case of intestine, active Lgr5
CUL4B belongs to the Cullin family which are scaffolding proteins for the E3 ubiquitin ligase complex CRLs, acting as a pivotal role in cell cycle regulation, DNA replication and DNA damage repair (DDR)[
In this study, we aimed to elucidate the dynamic function of CUL4B in the context of intestinal damage induced by IR. Before IR exposure, the deletion of CUL4B led to the downregulation of its binding protein PSME3, which enhanced p53 and subsequent promotion of apoptosis. After IR exposure, CUL4B translocated to the nucleus and localized at the γH2AX foci, leading to elevated p53 expression and inhibition of the damage recovery process. Our findings successfully explored the specific target molecules and mechanisms through which CUL4B is involved in the intestinal repair following IR treatment, offering potential insights for modulating intestinal damage repair process.
In order to explore the function of CUL4B in intestinal recovery from IR-induced damage, we successfully constructed models by exposing mice and IEC-6 cells to non-lethal doses of irradiation, respectively (Fig. 1A) (see "Methods" section). Our analysis revealed a significant increase in CUL4B expression following irradiation, which subsequently returned to baseline levels at 7 days post-irradiation in mice. Similarly, CUL4B expression peaked at 24 h post-irradiation in IEC-6 cells, and recovered to the unirradiated level at 48 h, implying that CUL4B plays a critical role in intestinal recovery process (Fig. 1B, C).
Graph: Figure 1 CUL4B disrupted IR induced intestinal damage and recovery. (A) Schematic overview of the mice (Cul4bWT and Cul4bΔIEC) model and the IEC-6 cells (shCul4b and shNC). Mice were sacrificed at 0, 1, 3, 5 and 7 days after 12 Gy whole-body irradiation and cells were collected at 0, 12, 24, 36 and 48 h after 3 Gy irradiation. (B, C) Western blot analysis of CUL4B expression in intestine of Cul4bWT mice (n = 3) after radiation at 0, 1, 3, 5 and 7 days and in IEC-6 cells after radiation at 0, 12, 24, 36 and 48 h (B) and statistical analysis (C). Three independent experiments were performed. Error bars represent SD. (D) Overall survival analysis of the Cul4bWT and Cul4bΔIEC mice post-irradiation. ns not significant, based on Log-rank test. (E) Statistical analysis of the body weight of the Cul4bWT and Cul4bΔIEC mice post-irradiation relative to day 0. (F, G) Representative H&E images of Cul4bWT and Cul4bΔIEC mice after radiation and the quantification of the length of crypt-villi (3 vs. 3) (F) and statistical analysis of villi length (G). Scale Bar = 50 μm. Error bars represent SD, *P < 0.05; **P < 0.01; ns not significant, based on Student's t test. The original western blots are presented in Fig. S6.
To further explore the function of CUL4B in intestinal recovery, we constructed epithelium-specific CUL4B deletion mice (Cul4b
As mentioned above, the absence of CUL4B resulted in more severe intestinal damage after radiation exposure, but the intestine possessed greater resilience compared to Cul4b
We analyzed the number of Ki67
Graph: Figure 2 CUL4B deficiency downregulated cell apoptosis post-IR. (A, B) Representative images and statistical analysis of immunochemical staining of Ki67+ cells per crypt in intestine from Cul4bWT and Cul4bΔIEC mice (A) and statistical analysis (B). Scale Bar = 20 μm. Error bars represent SD, *P < 0.05; **P < 0.01; ns not significant, based on Student's t test. (C, D) Representative images and statistical analysis of immunofluorescent staining of EdU+ cells in shCul4b and shNC IEC-6 cells (C) and statistical analysis (D). Blue: DAPI; Red: EdU+. Scale Bar = 200 μm. Three independent experiments were performed. Error bars represent SD, *P < 0.05; **P < 0.01; ***P < 0.001, based on Student's t test. (E-G) Western blot and statistical analysis of Caspase3, Cleaved-Caspase3 and p53 expression relative to GAPDH in intestine from Cul4bWT and Cul4bΔIEC mice after radiation at 0, 1, 3, 5 and 7 days and in shCul4b and shNC IEC-6 cells after radiation at 0, 12, 24, 36 and 48 h. Three independent experiments were performed. Error bars represent SD, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns not significant, based on Student's t test. The original western blots are presented in Fig. S6.
Given that the intestinal repair after IR injury proceeds via a p53-dependent pathway[
To further verify this hypothesis, we detected the downstream target genes of p53, Puma (p53 upregulated modulator of apoptosis) and Bax (BCL2 associated X, apoptosis regulator), through RT-qPCR and Western blot. Accordingly, RT-qPCR results showed that, consistent with the pattern of p53 expression, Puma and Bax were significantly upregulated in CUL4B-deficient, non-IR induced mice and IEC-6 cells, but expressed less in CUL4B-deficient, IR induced injury models (Fig. 3A, B). Similar changes were observed at the protein level (Fig. 3C-F). In brief, the coordinated expression of CUL4B and p53 protein, together with the apparent variation in p53 downstream gene expression, demonstrate that CUL4B could orchestrate intestinal injury repair through p53-mediated apoptosis.
Graph: Figure 3 Apoptosis associated p53 downstream genes were regulated by CUL4B. (A) RT-qPCR analysis of Puma and Bax expression in Cul4bWT and Cul4bΔIEC mice before and after radiation at 3 days. Error bars represent SD, *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001, based on Student's t test. (B) RT-qPCR analysis of Puma and Bax expression in shCul4b and shNC IEC-6 cells before and after radiation at 24 h. Error bars represent SD, *P < 0.05; **P < 0.01; ****P < 0.0001, based on Student's t test. (C, D) Western blot and statistical analysis of CUL4B and BAX expression in intestine from Cul4bWT and Cul4bΔIEC mice before and after radiation at 3 days. Error bars represent SD, ***P < 0.001; ****P < 0.0001, based on Student's t test. (E, F) Western blot and statistical analysis of CUL4B and BAX expression in shCul4b and shNC IEC-6 cells before and after radiation at 24 h. Error bars represent SD, *P < 0.05; **P < 0.01, based on Student's t test. The original western blots are presented in Fig. S6.
To identify the key factor that incorporate CUL4B dynamically regulating p53-mediated apoptosis, mass spectrometry was conducted to analyze the proteins that interacted with CUL4B in both unirradiated and 3-day post-irradiation small intestine tissues of mice. A total of 173 CUL4B-binding proteins were detected in the absence of radiation, while 81 CUL4B-binding proteins were detected in 3-day post-irradiation samples (full lists in Table S1-S3). Among these, 61 proteins were found to consistently bind to CUL4B after irradiation, while 112 proteins initially bound to CUL4B, but dissociated after irradiation (Fig. 4A). We also comprehensively analyzed differentiated expressional proteins and ubiquitylated proteins in intestines with CUL4B deletion (MS data in PRIDE: PXD-021528). Notably, the PSME3 protein was uniquely observed as the candidate key regulator among these proteins (Fig. 4A, B). PSME3 is a member of proteasome activator complex that mediates protein degradation and essential for protein homeostasis[
Graph: Figure 4 PSME3 bridged CUL4B and its regulation of p53. (A) Venn diagram of CUL4B binding-protein using MS in intestine of Cul4bWT and Cul4bΔIEC mice pre-IR and post-IR at 3 days. (B) Venn diagram of the overlap of up-regulated ubiquitylated proteins and down-regulated proteins identified in Cul4bΔIEC mice compared with Cul4bWT mice. (C) Changing folds and detail modification site of PSME3. (D, E) Western blot and statistical analysis of the expression of p53 in Psme3-knockdown (siPsme3) and PSME3-overexpressed (OE PSME3) IEC-6 cells relative to control (siNC and OE NC). Error bars represent SD, **P < 0.01; ***P < 0.001; ****P < 0.0001, based on Student's t test. The original western blots are presented in Fig. S6.
To further investigate the role of PSME3 in CUL4B-coordinated repair of IR-damage intestine, we initially evaluated the binding of CUL4B to PSME3 pre- and post-irradiation. Immunoprecipitation experiments on intestinal tissues of both unirradiated and irradiated mice revealed a reduction in the amount of PSME3 combined with CUL4B after radiation (Fig. 5A, B). Coordinately, proximity ligation assay (PLA) was conducted on tissue slices of unirradiated and irradiated mice small intestine to visualize the interaction between CUL4B and PSME3. Consistently, the fluorescent signal that indicating the binding of CUL4B and PSME3 protein were significantly decreased after IR exposure (Fig. 5C, D). Moreover, PSME3 expression was downregulated in CUL4B deletion mice and IEC-6 cells, confirming the interaction between CUL4B and PSME3 (Fig. 5E, F).
Graph: Figure 5 CUL4B deletion diminished PSME3 expression to up-regulate p53 before IR. (A, B) Immunoprecipitation and statistical analysis of the binding of CUL4B and PSME3 in intestines from Cul4bWT mice pre-IR and post-IR at 3 days. Error bars represent SD, ***P < 0.001, based on Student's t test. (C, D) Representative images and statistical analysis of PLA in intestine from Cul4bWT mice pre-IR and post-IR at 3 days. Blue: DAPI; Red: binding signal. Scale Bar = 50 μm. Error bars represent SD, ****P < 0.0001, based on Student's t test. (E, F) Western blot analysis and statistical analysis of PSME3 expression in Cul4bWT and Cul4bΔIEC mice and shCul4b and shNC IEC-6 cells. Error bars represent SD, **P < 0.01; ***P < 0.001, based on Student's t test. (G) Western blot analysis of the ubiquitination level of CUL4B on PSME3 in siNC and siCul4b IEC-6 cells. (H, I) Western blot analysis and statistical analysis of the stability of PSME3 in shCul4b and shNC IEC-6 cells at 0, 8, 16 and 24 h after CHX treatment. Error bars represent SD, *P < 0.05; **P < 0.01, based on Student's t test. (J, K) Western blot analysis of the P53, PSME3 and Cleaved-Caspase3 expression in siNC, siCul4b and siCul4b IEC-6 cells transfected with PSME3-expression plasmid. Error bars represent SD, *P < 0.05; ****P < 0.0001, based on Student's t test. The original western blots are presented in Fig. S6.
Given the important role of CUL4B in ubiquitination modifications, the ubiquitination modification of PSME3 was further examined. It was found that the level of ubiquitination of PSME3 was increased in shCul4b IEC-6 cells, resulting in enhanced protein instability and shortened half-life (Fig. 5G-I), suggesting that CUL4B could inhibit PSME3 ubiquitination and thus maintain the long-term presence of PSME3. As mentioned above, overexpression of Psme3 lead to the decrease of p53 expression. Therefore, we assume that CUL4B potentially regulating downstream p53 pathway activation through ubiquitination of PSME3. To verify this hypothesis, we detected whether the presence of PSME3 interfered with the effect of CUL4B on p53 expression. Addition of PSME3 in CUL4B deficiency cells significantly blocked the accumulation of p53 induced by CUL4B deletion (Fig. 5J, K), verifying that the presence of PSME3 inhibited the facilitation of p53 expression induced by CUL4B.
Taken together, PSME3 was a pivotal factor in the CUL4B modulation of p53-mediated apoptosis before IR, with CUL4B maintaining the existence of PSME3 by inhibiting its ubiquitination, and the persistent presence of PSME3 inhibiting the expression of p53, thereby suppressing the occurrence of apoptosis.
We have shown that CUL4B inhibits ubiquitination of PSME3 and thus impedes p53 protein expression in unirradiated mice. However, following radiation treatment, CUL4B no longer bound to PSME3 and deficiency of CUL4B not hinders but assists with intestinal recovery from radiation-induced damage, suggesting that CUL4B exerts a different mechanism during damage repair. It has been reported that nuclear localization of CUL4B is critical for its regulation of cell proliferation, so we speculate that CUL4B plays a different functional role after experiencing damage possibly due to its translocation in cells. Therefore, we detected the subcellular localization of CUL4B protein through immunofluorescence and nucleoplasm separation. At 3 days post-irradiation, a markedly increased percentage of nuclear importation of CUL4B was detected (Fig. 6A, B). More importantly, by measuring CUL4B in separated nucleoplasm, we found that CUL4B protein bound to chromatin was significantly elevated after irradiation (Fig. 6C, D), suggesting that CUL4B might enter the nucleus and positioned at the site of DNA damage after irradiation.
Graph: Figure 6 CUL4B converted subcellular localization and repressed DDR. (A, B) Representative images of immunofluorescent staining of CUL4B+ cells and statistical analysis of the rate of nuclear import of CUL4B pre-IR and post-IR at 3 days in intestine from Cul4bWT mice. Scale Bar = 50 μm. Error bars represent SD, **P < 0.01, based on Student's t test. (C, D) Western blot and statistical analysis of the CUL4B expression of cytoplasmic (HSP90 as control), nuclear (HDAC2 as control) and chromatin-bound (H3 as control) in intestine from Cul4bWT mice pre-IR and post-IR at 3 days. Error bars represent SD, **P < 0.01; ***P < 0.001; ns not significant, based on Student's t test. (E, F) Immunoprecipitation analysis of CUL4B and γH2AX in intestine from Cul4bWT mice pre-IR and post-IR at 3 days. Error bars represent SD, ***P < 0.001, based on Student's t test. (G, H) Western blot and statistical analysis of CUL4B and γH2AX expression in intestine after radiation at 3, 5 and 7 days. Error bars represent SD, *P < 0.05; **P < 0.01; ****P < 0.000, based on Student's t test. (I, J) Western blot and statistical analysis of CUL4B, BRCA1 and p-BRCA1 expression in intestine after radiation at 3, 5 and 7 days. Error bars represent SD, **P < 0.01; ****P < 0.0001, based on Student's t test. (K, L) Western blot and statistical analysis of CUL4B and RAD51 expression in intestine at 3 days post IR. Error bars represent SD, **P < 0.01; ****P < 0.0001, based on Student's t test. The original western blots are presented in Fig. S6.
γH2AX, an indicator of DNA damage induced by radiation and the loss rate of which correlated with the rate of DBS repair[
Taken together, our findings suggest that while CUL4B can inhibit p53-mediated apoptosis by coordinating and regulating PSME3 before irradiation. After irradiation, CUL4B dissociated from PSME3 and located at γH2AX foci in nuclear. On one hand, CUL4B deficiency diminished PSME3 expression and upregulated p53-mediated apoptosis upon damage. On the other hand, loss of nuclear CUL4B ultimately accelerated the cellular repair of DNA damage (Fig. 7).
Graph: Figure 7 CUL4B plays a dynamic role in p53-mediated cell apoptosis during IR-induced intestine damage repair.
The dependence of p53 signals characterizes IR-induced damage to the epithelium of small intestine[
It has been reported that CUL4B-DDB1 (DNA damage-binding protein 1) targeted to UV-damage chromatin and initiated efficient nucleotide excision repair (NER)[
The occurrence of cell apoptosis is the consequence of redundancy DNA damage after radiation, in which p53 is a key factor and affected by multiple upstream signals. Nevertheless, it is worth noting the controversial role of p53 in cell specificity. p53 deficiency blocks apoptosis of most intestine epithelial cells and crypt cells rather than endothelial cells[
PSME3 is a member of the 11S proteasome activator, which binds and activates the 20S proteasome in a ubiquitin and ATP-independent manner[
In conclusion, our findings demonstrate an inventive function of CUL4B during the intestine damage and recovery stage caused by radiation. CUL4B binds to PSME3 to inhibit the expression of p53 without any stimulation but abandons PSME3 to bound with γH2AX at the DNA damage sites on chromatin and down-regulates phosphorylation of the DNA repair protein BRCA1 and RAD51 after radiation. In addition, CUL4B has been reported to be overexpressed in a range of cancers and promotes carcinogenesis through regulating multiple cellular malignant behaviors[
Pvillin-Cre mice (strain: C57BL/6J, stock number: T0116) were procured from Model Animal Research Center (MARC). Cul4b
Table 1 Primer sequence for genotyping.
Sequence (5′–3′) CCCGCAGAACCTGAAGATG GACCCGGCAAAACAGGTAG ACAGGTATTTGCCAGTGCTGTC TTCTGTTACCTTCCTACCGAGAG
The small intestine was fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned with a thickness of 4 μm. Some slides were stained with H&E for assessing intestine morphology. Some slides were cooked in 0.01 mol/L sodium citrate solution (pH 6.0) for 15 min, and incubated with 3% H
IEC-6 cells were digested and added onto the sterile microscope slides pre-treated with polylysine at 5000 cells per well of 24-well plate. After 24 h post IR, the slides were washed by PBS and fixed with Immunol Staining Fix Solution (Beyotime, P0098) for 30 min. And then, the slides were treated with 0.5% TritonX-100, blocked with 10% goat serum for 1 h at room temperature, and incubated at 4 °C with primary antibodies overnight, followed by secondary antibodies. Anti-CUL4B (Sigma-Aldrich, Cat# C9995), anti-RAD51 (Abcam, ab133534) and anti-γ-H2AX (EMD Milipore, 05-636-25μg) were used as primary antibodies. Anti-rabbit Rhodamine (Jackson ImmunoResearch, 111-025-003) and anti-mouse Fluorescein (Jackson ImmunoResearch, 115-095-003) were used as secondary antibodies. Images were captured with OLYMPUS BX51.
IEC-6 was procured from Nanjing Foksay Biotechnology Co., Ltd. IEC-6 was cultured in DMEM (Gibco, 11965167) with 10% fetal bovine serum (Gibco, 10099-141C), penicillin (100 mg/mL, BBI, A600135) and streptomycin (100 mg/mL, BBI, A100382) at 37 °C in a humidified atmosphere (5% CO
For protein stability assay, shCul4b and shNC were transfected with Psme3-expression plasmid and treated with cycloheximide (CHX, MCE, HY-12320, 120 μg/mL) to inhibit protein synthesis and collected at 0, 8, 16 and 24 h for immunoblotting.
For ubiquitination assay, IEC-6 were transfected with indicated plasmids or siRNAs (GenePharma Co., Ltd) and treated with MG132 (MCE, HY-13259, 20 μM). Cells were harvested with PBS containing NEM (MCE, HY-D0843S, 10 μM) to prevent deubiquitination, and then lysed in cell lysis buffer containing Tris 8.0 (10 mM), NaCl (150 mM) and 2% SDS by boiling at 95 °C for 10 min, followed by sonication (8 s, 1 cycle). Lysed sample supernatants were then incubated with anti-PSME3, mixed with protein A/G PLUS-Agarose (Santa Cruz, sc-2003) for 12 h at 4 °C, followed by Western blot.
For analysis of apoptosis, IEC-6 cells were fixed and stained with PE Annexin V Apoptosis Detection kit with 7-AAD (Vazyme, A213-01) according to the manufacturer's instructions. The proportion of PI-positive and PE-positive cells were recorded. Data acquisition was performed on Accuri C6 Plus and analyzed via FlowJo (RRID:SCR_008520).
For RNA isolation, intestine tissues were lysed in Trizol (Invitrogen, 15596018) and reversely transcribed with HiScript III RT SuperMix for qPCR (Vazyme, R323). RT-qPCR analysis was performed with SYBR Green Mixture (Roche, 4729692001) in qTOWER3G. The primers for RT-qPCR were designed using Primer3 (RRID:SCR_003139) and BLAST through NCBI and listed in Table 2. Gene expression was normalized to the referee Gapdh or Rps18 to control.
Table 2 Primers for RT-qPCR.
Sequence (5′–3′) AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA ATGAGCCAAACCTGACCACT TGAGATGGATGGGGATTGGG AGACAGGGGCCTTTTTGCTAC AATTCGCCGGAGACACTCG TGGAAGTTCATTTACCACCAGAGATG TTCTGCTTTTAACACACAGTGTCCTA CCAAGAGGTGAGTGCTTCCC CTGTTGTTCAGACTCTCTCCCT GCCCATCCTCTGTGACTCAT AGGCCACAGGTATTTTGTCG GACGTGGAACTGGCAGAAGAG TTGGTGGTTTGTGAGTGTGAG CAGCTCCAAGAAAGGACGAAC GGCAGTGTAACTCTTCTGCAT ATCCCCGAGAAGTTTCAGCA ATTGTCGTGGGTTCTGCATG AAACCTGACCACTAGCCTCC AATGGGATGGATGGGGACTG GAGACACCTGAGCTGACCTT CGTCTGCAAACATGTCAGCT TTAAGGAACGGGTGGCTGAT AATCTCTGGGTTGTGGAGGG
Total proteins were extracted with Trizol, protein lysis or Subcellular Protein Fractionation Kit for Tissues (Thermo, 87790) following the manufacturer's instructions. A total of 40 μg of protein were separated on a 10% SDS-PAGE and transferred onto a PVDF membrane. The membranes were blocked with 5% fat-free milk in Tris-buffered saline (TBS) containing 0.1% Tween-20 (BBI, 9005-64-51) for 1 h at room temperature and then incubated with primary antibodies against CUL4B (Sigma-Aldrich, Cat# C9995), GAPDH (Cell Signaling Technology, Cat# 5174, RRID:AB_10622025), ACTIN (Santa Cruz, sc-69879), p-TBK1 (Ser172, Cell Signaling Technology, Cat# 5483), STING (p-STING, Cell Signaling Technology, Cat# 50494), p53 (Santa Cruz, sc-126), Caspase3 (Proteintech, 19677–1-AP), Cleaved-Caspase3 (Cell Signaling Technology, Cat# 9661), BAX (Cell Signaling Technology, 2772), PSME3 (Cell Signaling Technology, 95128S), γ-H2AX (EMD Milipore, 05-636-25ug), HSP90 (Cell Signaling Technology, C45G5), HDAC2 (Cell Signaling Technology, 57156), BRCA1 (Cell Signaling Technology, 9010T), p-BRCA1 (Ser1524, Cell Signaling Technology, 9009T) and RAD51 (Abcam, ab133534) overnight at 4 °C. The membranes were washed in TBST and incubated with HRP-labeled secondary antibody (anti-rabbit: Jackson ImmunoResearch, 111-005-003; anti-mouse: Jackson ImmunoResearch, 115-005-003) for 1 h at room temperature. The blots were cut prior to hybridisation with antibodies during blotting. After incubation, membranes were washed and proteins were detected using a SuperSignal Chemiluminescence kit (Thermo, 34580).
Protein supernatants were incubated with indicated antibodies and protein A/G PLUS-Agarose (Santa Cruz, sc-2003) for 2 h at 4 °C. Immunoprecipitates were boiled in sample loading dye at 95 °C for 5 min, followed by Western blotting.
EdU staining of IEC-6 was performed with Cell-LightTM EdU Apollo 567 In Vitro Kit (RiboBio, C10310-1) following the manufacturer's instructions. EdU medium (1:1000) was added when IEC-6 cells were passaged and incubated for 2 h at 37 °C in a humidified chamber with 5% CO
Experimental operation was performed with biological or independent replicates. Statistical analysis was performed using GraphPad Prism. Data significance was analyzed using unpaired, two-tailed Student's t test or Log-rank test. Bar graphs represented mean ± standard deviation (SD). P values * < 0.05, ** < 0.01, *** < 0.001, **** < 0.0001, ns not significant.
We sincerely thank Translational Medicine Core Facility of Shandong University for consultation and instrument availability that supported this work. We thank Professor Jingxin Li, Professor Wei Zhao and Dr Qiao Liu for technological support and lab source help such as antibodies for WB and IF.
H.H., J. W., and Y.G. conceived the project and designed experiments. B.G., X.H. and X.X. preformed experiments data analysis. B.G. visualized the data. X.Z., J. W. and J.L. provided methodology. X.Z., Y.G., H.D. and Y.F. supervised and administrated the project. B.G. and Y.M. wrote the manuscript. H.H. revised the manuscript. All authors read and approved the final manuscript.
This work was supported by the Funds for Taishan Youth Expert of Shandong Province, Shandong Province National Outstanding Young Scholars Foundation (ZR2021JQ11), Youth Interdisciplinary Innovation Research Group of Shandong University 2020QNQT003 and Key Research and Development Program of Shandong Province (2022CXGC020501) to H.H., and Shandong Provincial Natural Science Foundation (ZR2020MH221) to J.W.
The mass spectrometry data in this study are provided in Table S1–S3 and other detailed data are available upon request from the huhuili@sdu.edu.cn.
The authors declare no competing interests.
Graph: Supplementary Figures.
Graph: Supplementary Table S1.
Graph: Supplementary Table S2.
Graph: Supplementary Table S3.
Graph: Supplementary Table S4.
Graph: Supplementary Table S5.
Graph: Supplementary Table S6.
The online version contains supplementary material available at https://doi.org/10.1038/s41598-024-60704-4.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Beibei Guo; Xiaohan Huo; Xueyong Xie; Xiaohui Zhang; Jiabei Lian; Xiyu Zhang; Yaoqin Gong; Hao Dou; Yujia Fan; Yunuo Mao; Jinshen Wang and Huili Hu
Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author