Background: Gestational diabetes (GDM) is a common complication of pregnancy. The impact of pregnancy complications on placental function suggests that extraembryonic stem cells in the placenta may also be affected during pregnancy. Neonatal tissue-derived stem cells, with the advantages of their differentiation capacity and non-invasive isolation processes, have been proposed as a promising therapeutic avenue for GDM management through potential cell therapy approaches. However, the influence of GDM on autologous stem cells remains unclear. Thus, studies that provide comprehensive understanding of stem cells isolated from women with GDM are essential to guide future clinical applications. Methods: Human chorionic membrane-derived stem cells (CMSCs) were isolated from placentas of healthy and GDM pregnancies. Transcriptional profiling was performed by DNA microarray, and differentially regulated genes between GDM- and Healthy-CMSCs were used to analyse molecular functions, differentiation, and pathway enrichment. Altered genes and biological functions were validated via real-time PCR and in vitro assays. Results: GDM-CMSCs displayed, vs. Healthy-CMSCs, 162 upregulated genes associated with increased migration ability, epithelial development, and growth factor-associated signal transduction while the 269 downregulated genes were strongly linked to angiogenesis and cellular metabolic processes. Notably, significantly reduced expression of detoxification enzymes belonging to the aldehyde dehydrogenase gene families (ALDH1A1/1A2, ALDH2, ALDH3) accounted for downregulation across several metabolic pathways. ALDH activity and inhibitor assays indicated that reduced gene expression of ALDHs affected ALDH enzymatic functions and resulted in oxidative stress dysregulation in GDM-CMSCs. Conclusion: Our combined transcriptional analysis and in vitro functional characterisation have provided novel insights into fundamental biological differences in GDM- and Healthy-CMSCs. Enhanced mobility of GDM-CMSCs may promote MSC migration toward injured sites; however, impaired cellular metabolic activity may negatively affect any perceived benefit.
Keywords: Aldehyde dehydrogenase; Chorionic stem cells; Gestational diabetes; Microarray analysis; Migration
Mesenchymal stem cells (MSCs) are present in many adult tissues and play a role in tissue regeneration and maintenance. Their regenerative potential provides numerous benefits for disease treatment [[
The placenta has a pivotal role in embryogenesis and contains plentiful undifferentiated stem cells and as part of the extraembryonic tissue, and stem cells can be isolated from the placenta without additional invasive procedures or additional ethical concerns [[
A microarray study on umbilical vein endothelial cells derived from GDM pregnancies indicated altered gene expression in insulin sensing and extracellular matrix reorganisation [[
With increasing interest in the utilisation of placental MSCs and their banking for clinical purposes, understanding the characteristics and regenerative potential of placental MSCs has become an important subject. Thus, we sought to explore gene expression profiles between CMSCs isolated from healthy and GDM placenta and establish biological differences or similarities. Our findings demonstrate the influence of GDM on CMSC transcriptional profiles with corresponding changes in functionality through in vitro assays. The observed enhanced migration and epithelial development potential in GDM-CMSCs may have clinical benefits for wound healing. On the other hand, the decreased expression and activity of ALDH detoxification enzymes in GDM-CMSCs leads to downregulation of several degradation pathways and an impaired ability to respond to oxidative stress. The comprehensive understanding of GDM-CMSCs reveals the benefits and disadvantages of utilising CMSCs from GDM pregnancies for future regenerative medicine.
Placenta samples were obtained with informed written consent and in accordance with procedures approved by the Research Ethics Committee and Health Research Authority (Reference 15/WM/0342). Full-term placentas from 10 healthy and 11 GDM pregnancies were collected from Royal Stoke University Hospital, UK.
All placentas were collected immediately after caesarean section, and cell isolation was performed within 1 h. CMSCs were isolated from the chorionic membrane and characterised by immunophenotyping with high levels of expression of typical MSC markers CD73, CD90, and CD105 and low levels of CD14, CD19, CD34, CD45, and HLA-DR. CMSC isolation, as previously described [[
0.2 μg of total RNA was amplified and labelled with Cy3 (CyDye, Agilent Technologies) for in vitro transcription process. Labelled cRNA was pooled and hybridised to Agilent SurePrint Microarray (Agilent Technologies) according to the manufacturer's protocol. Arrays were scanned with an Agilent microarray scanner and images analysed by Feature extraction10.7.3.1 software (Agilent Technologies).
Venn diagram and hierarchical clustering heat maps were created by AltAnalyze software (Gladstone Institution, UCSF) and used to identify commonly upregulated or downregulated genes and illustrate the differentially expressed gene lists of interest.
Ingenuity Pathway Analysis (IPA, Qiagen;
Pathway network visualisation was created by Cytoscape v.3.6.1. Enriched gene sets identified by IPA pathway analysis were selected and used as input nodes. The interaction network was generated according to literature findings and public database. The network was manually curated and distributed with circles for easier visualisation.
Total RNA were isolated at passage 3, using TRIzol Reagent (Invitrogen) according to the manufacturer's instruction. Reverse transcription was performed with High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific). Gene expression analysis was evaluated by real-time PCR using QuantiFast SYBR Green PCR Kit (Qiagen). Primer sequences are shown in Table 1. The relative expression levels of mRNA were normalised to GAPDH, and fold change was calculated using the 2^-(ΔΔCt) method.
Primer sequences
Genes Forward sequence Reverse sequence CD24 CTCCTACCCACGCAGATTTATTC AGAGTGAGACCACGAAGAGAC AQP1 CTGCATGGTCAAGCCTCTTA TCAAGGGAGTGGGTGAATTG FLNB TGATCTATGTGCGCTTCGGT GACATGCATTTACCGGTGCC CELSR1 TACTTCTGCGGTGCTGGTTT GTCCGTAAACCGTCCCTTCC EDN1 CCATGAGAAACAGCGTCAAATC CGAAGGTCTGTCACCAATGT HBEGF AATCTGGCTTAGTGCCACCC GCACTCTGACCACGGAAGAT TGFB2 ATGCGGCCTATTGCTTTAGA ACCCTTTGGGTTCGTGTATC CTCF GCCTGTTCCAAGACCTGTG GGCGGCTCTGCTTCTCTA NKX2.5 CAACATGACCCTGAGTCCCC TAATCGCCGCCACAAACTCT NOG CATGCCGAGCGAGATCAAA CAGCCACATCTGTAACTTCCTC PDGFA GGAACGCACCGAGGAAGA GCCAGGAGGAGGAGAAACAG NPPB TGGAAACGTCCGGGTTACAG GACTTCCAGACACCTGTGGG MET TGGTGCAGAGGAGCAATGG CATTCTGGATGGGTGTTTCCG CXCL12 ATGAACGCCAAGGTCG GGGCTACAATCTGAAGGG RASIP1 CGTCTCCTTGAGAACCAATACC CATTCCACGCGGGATAAGAA RSPO3 CACCTTTATCTGAGCCAATGGA ATGCAGGGGGATCTGACATA HMOX1 TCTTGGCTGGCTTCCTTACC GGATGTGCTTTTCGTTGGGG ALDH1A1 TCAAACCAGCAGAGCAAACT TAGGCCCATAACCAGGAACA ALDH2 CTGCTGACCGTGGTTACTT CTCCCAACAACCTCCTCTATG ALDH3B1 GCTGAAGCCATCGGAGATTAG GCTCCCTGTGAAGAAGATGTAG NQO1 GGGATGAGACACCACTGTATTT AGTGATGGCCCACAGAAAG SOD2 GGACAAACCTCAGCCCTAAC GCCGTCAGCTTCTCCTTAAA GAPDH ACTTCAACAGCACACCCACT GCCAAATTCGTTGTCATACCAG
Cells were placed onto the upper chamber of a Transwell filter with 8-μm pores (Corning), and the bottom well contained regular growth media culturing in a 37 °C incubator. After 8 and 24 h, migrated cells were fixed with methanol and stained with crystal violet. Migration was quantified by cell counts in five separate fields per sample and expressed as mean numbers. Data represent 6 independent experiments in each group, performed in triplicate.
5 × 10
ALDH function was measured by aldehyde dehydrogenase activity colorimetric assay kit (Sigma). Acetaldehyde is oxidised by ALDH generating NADH which reacts with a probe and the activity of ALDH measured by absorbance reading at 450 nm. Cells were lysed by ALDH buffer and manufacturer's protocol followed. Absorbance was measured every 5 min over a 30-min period. The activity of ALDH was calculated according to the manufacturer's suggestion. All samples were performed in triplicate.
ROS was detected by 2′,7′-dichlorofluorescin diacetate (DCFDA, also known as H
All statistics were calculated by GraphPad Prism 6 software. Student's t test was used to compare paired or unpaired data. Values are presented as mean ± SEM, and p < 0.05 is determined as significant: *p < 0.05, **p < 0.01, and ***p < 0.001.
Gene expression profiles of CMSCs derived from 3 healthy (H-CMSCs) and 3 GDM women (GDM-CMSCs) were determined by DNA microarray analysis. Validation of microarray results was performed with 10 H-CMSCs and 11 GDM-CMSCs samples. Applying a cut-off of p < 0.05 and 1.5-fold change between H-CMSCs and GDM-CMSCs, we identified a total of 431 differentially expressed genes (DEGs), including 162 upregulated and 269 downregulated genes in all 3 GDM samples (Fig. 1a). The 3 GDM women were treated for their GDM with either metformin (GDM6), insulin (GDM7), or both (GDM8). The sample from the women who received both metformin and insulin treatment exhibited the highest number of total DEGs.
Graph: Fig. 1 Identification of DEGs and enriched biological functions in GDM-CMSCs. a Venn diagram indicates the numbers of genes up- or downregulated > 1.5-fold in GDM-CMSCs vs. Healthy-CMSCs. The overlapping areas of the 3 circles are co-regulated genes and defined as differentially expressed genes (DEGs). b Biological functions in "molecular and cellular functions" category were generated and ranked by IPA analysis. Bars indicate overrepresented functions in GDM-CMSCs compared to H-CMSCs. Individual GDM-MSC samples are represented via specific indicated colours. c Activation state of enriched downstream cellular processes in "molecular and cellular functions" using IPA activation z-score identification of increased (positive z-score) or decreased activity (negative z-score) in GDM-CMSCs compared to Healthy-CMSCs. d Heat maps of DEGs involved in cell survival and growth, cellular movement and assembly, skin formation, and epithelial development. Expression levels are represented by log2 fold change (expression value in each sample vs. mean expression value in Healthy-CMSCs). Expression levels range from high (red) to low (green). e Biological functions in "physiological system development and function" category in GDM-CMSCs identified by IPA. f Cellular processes associated with "cardiovascular system development and function" in GDM-CMSCs. The activation state was calculated by IPA activation z-score. g Heat maps summarised DEGs involved in cardiogenesis and vasculogenesis
Biological function analysis using DEGs identified in all 3 GDM-CMSCs samples was performed with Ingenuity Pathway Analysis (IPA) focussed on two categories: "molecular and cellular functions" and "physiological system development and functions". Applying a cut-off of average -log(p value) > 30 using Fisher's exact test, the most represented "molecular and cellular functions" in GDM-CMSCs were related to cell death and survival, cellular growth and proliferation, and cellular movement (Fig. 1b). To further identify the altered downstream cellular process of the most represented biological functions, the activation z-score computed by IPA was used to infer the activation/inhibition state and gene enrichment. A positive z-score indicates increased functional activity in GDM-CMSCs relative to H-CMSCs while a negative z-score indicates a reduction in activity. Positively associated cellular processes in GDM-CMSCs included cell survival, viability, cellular migration and movement, assembly and organisation of cytoskeleton, and skin formation, which are critical functions in wound repair and tissue remodelling (Fig. 1c). DEGs in GDM-CMSCs associated with the positively regulated cellular processes were displayed by gene clustering heat maps, indicating the upregulated expression levels and increased wound healing and remodelling potential (Fig. 1d). Noticeably, organismal death was the most downregulated cellular process in GDM-CMSCs while other negatively associated functions including stimulation of cells, homing, and colony formation showed less significant z-score values (Fig. 1c).
In terms of the tissue regenerative potential of GDM-CMSCs, the most represented biological function in the "physiological system development" category was cardiovascular system development and function, which had an average -log(p value) > 30 (Fig. 1e). Further in-depth analysis of the downstream functional activation performed in relation to cardiovascular system development showed that cardiogenesis was the most significantly overrepresented downstream cellular process with the highest positive z-score, along with the positive association with development of cardiovascular tissue (Fig. 1f). The heat map illustrated a set of genes involved in cardiogenesis that were highly expressed in GDM-CMSCs compared to H-CMSCs, suggesting the greater potential of GDM-CMSCs in cardiac regeneration (Fig. 1g). In contrast, the cellular processes of vasculogenesis and angiogenesis in cardiovascular development had decreased activation with negative z-scores (Fig. 1f). The heat map showed the downregulation of vasculogenesis and vasculature development-associated genes in GDM-CMSCs compared with H-CMSCs (Fig. 1g). Moreover, other enriched downstream cellular processes in the "physiological system development" category included respiratory system development and formation of the lung and kidney with a positive z-score while development of the exocrine gland and connective tissue had negative z-scores in GDM-CMSCs (Additional file 1: Figure S1).
To evaluate functional differences between H-CMSCs and GDM-CMSCs, elevated expression of genes involved in migration, survival, and cellular assembly ability in GDM-CMSCs were validated through real-time PCR and migration assays. DEGs associated with cell migration (CD24, AQP1), cellular assembly (FLNB, CELSR1), and skin formation and healing process (EDN1, HBEGF, TGFB2, CTGF) were significantly upregulated in GDM-CMSCs compared to H-CMSCs (Fig. 2a and Additional file 2: Figure S2a). Transwell migration was performed to examine cell motility, where H-/GDM-CMSCs were placed into the upper compartment of a Transwell filter and allowed to migrate through the filter for 8 and 24 h. After either 8 or 24 h of incubation, enhanced migration ability was observed in GDM-CMSCs with a greater number of cells having migrated across the membrane (Fig. 2b, c). In wound healing assays, higher numbers of GDM-CMSCs migrated into the wound field at every observed time point (
Graph: Fig. 2 Validation of gene expression and altered biological functions in GDM-CMSCs through real-time PCR and in vitro migration assays. a Upregulation in genes associated with cell migration/cellular assembly (CD24, FLNB, AQP1) and wound healing (EDN1, HBEGF) in GDM-CMSCs validated by real-time PCR with 10 Healthy- and 11 GDM-CMSCs samples. Gene expression levels were normalised to GAPDH and presented as fold change by comparing G-CMSCs to H-CMSCs using 2^-(ΔΔCt) method. b Motility of cell was evaluated by Transwell migration assay. Representative images of migrated Healthy-CMSCs and GDM-CMSCs stained with crystal violet after 8 and 24 h of migration period. Scale bar 150 μm. c Cell migration ability was calculated by counting migrated cells per field by ImageJ. Data represent 6 independent experiments in triplicate. d The graph indicates wound closure percentages, and the images below are representative images of wound healing assay. Healthy-CMSCs and GDM-CMSCs migrated into the middle wound field after 12 h. The percentage of wound closure was calculated by measuring the reduced wound area after 6 h and 12 h by ImageJ. Data were obtained from 6 independent experiments. Scale bar 150 μm. e Significant upregulation of cardiogenic genes in GDM-CMSCs. Validation of NKX2.5, NOG, and PDGFA expression in healthy and GDM samples was examined by real-time PCR. The expression level of each gene was normalised to GAPDH. f Significant downregulation of vasculogenic genes in GDM-CMSCs. RASIP1, CXCL12, and RSPO3 expressions were validated by real-time PCR. The expression level of each gene was normalised to GAPDH. All error bars in this figure are presented as mean ± SEM. Student's t test was used for statistical significance, *p < 0.05, **p < 0.01, ***p < 0.001
Cardiovascular development was identified as the most enriched biological function in GDM-CMSCs with altered gene expression in cardiogenesis and vasculogenesis. The expression of genes associated with cardiogenesis (NKX2.5, NOG, PDGFA, NPPB, MET) showed significant increases in GDM-CMSCs vs. H-CMSCs (Fig. 2e and Additional file 2: Figure S2b). The opposite trend was found in vasculogenesis-associated genes, which showed a significantly reduced expression of RASIP1, CXCL12, RSPO3, and HMOX1 in GDM-CMSCs (Fig. 2f and Additional file 2: Figure S2b). Taken together, CMSCs derived from GDM placenta may therefore have better potential application in wound repair and cardiogenesis than in vasculogenesis when compared to H-CMSCs.
Gene regulatory networks were examined incorporating DEGs for positively regulated (Fig. 3a) and negatively regulated pathways (Fig. 3b). The STAT3 pathway, with roles in development, cellular homeostasis, cell growth, proliferation, and differentiation [[
Graph: Fig. 3 Positively and negatively regulated pathway analysis and regulatory network visualisation. a, b IPA canonical pathway analysis of positively and negatively regulated pathways in GDM-CMSCs. The x-axis indicates the altered canonical pathways in GDM-CMSCs. The left y-axis indicates the statistical significance p value, calculated using Fisher's exact test. The right y-axis represents the ratio of the number of dataset genes that map to all known pathway genes. c, d Positively regulated canonical pathways and associated genes. Hierarchical clustering maps indicate the expression of genes involved in BMP, Wnt/β-catenin, FGF signalling, and Rho family signalling. From left to right on the clustering maps are presenting as GDM6, GDM7, and GDM8 samples. Each gene is normalised to a mean expression of 3 Healthy-CMSCs samples. Blue and red indicate below and above mean expression, respectively, with values indicating log2 fold change. e, f Negatively regulated canonical pathways and associated genes. Interaction networks were generated by Cytoscape visualisation based on DEGs. Hierarchical clustering map showed a significant reduction in ALDH family gene expression in GDM-CMSCs and regulators of the Nrf2 pathway
Moreover, the increased activity of Rho family GTPase signalling in GDM-CMSCs, including Rac, RhoA, and Cdc42 signalling, associates with the regulation of cell migration, invasion, and cytoskeleton organisation [[
Among the downregulated metabolic pathways, most were associated with degradation processes, including ethanol degradation, oxidative ethanol degradation, and fatty acid α-oxidation as well as the degradation of neurotransmitters (histamine, dopamine, noradrenaline, serotonin) and other molecules (putrescine, tryptophan) (Fig. 3b). Given the dysfunctional metabolic regulation in women with GDM, these pathways are of particular interest for investigating GDM-CMSCs behaviours. Figure 3e illustrates the genes associated with these enriched downregulated pathways and showed that the decreased activities of degradation pathways were connected to the significant reduction in aldehyde dehydrogenase family gene expression, ALDH1, ALDH2, and ALDH3 (Fig. 3e). Aldehydes can be formed during the metabolism of amino acids, carbohydrates, lipids, and vitamins as well as cytotoxic drugs and environmental chemicals [[
Top 10 upregulated and downregulated genes in GDM-CMSCs vs. Healthy-CMSCs
Top 10 downregulated genes Average log2 ratio PRKCB − 5.566 GJA8 − 4.166 CXCL12 − 3.436 FAM20A − 3.379 ALDH1A1 − 3.315 PRRX2 − 3.227 ATP8B4 − 3.040 RSPO3 − 2.927 CXCL3 − 2.925 CXCL1 − 2.914 Top 10 upregulated genes Average log2 ratio RPS4Y1 9.873 COL17A1 9.344 DDX3Y 8.528 CDH1 8.376 KRT5 8.308 SCEL 8.207 SPRR3 7.823 PLD5 7.293 HAPLN1 7.102 L1TD1 6.996
Other downregulated pathways, such as "IL-6 signalling" and "HGF signalling", regulate multiple molecules involved in angiogenesis (Fig. 3b). For instance, CEBPB, FOS, ELK1, and CXCL8 in angiogenesis pathways displayed low expression in GDM-CMSCs. Moreover, the downregulation of "PI3K/AKT signalling" may affect the potent angiogenic factors, IL-6, IL-8, HGF, and VEGF signalling transduction through mediation of the PI3K/AKT pathway to promote angiogenesis [[
Given that the decreased expression of ALDH family genes affected several metabolic pathways and the negative activation of Nrf2-mediated oxidative stress regulation, GDM-CMSCs are likely to have imbalanced cellular ROS regulation as reflected in increased oxidative stress which are found in diabetic tissues [[
Graph: Fig. 4 Decreased ALDH activity and increased cellular ROS level in GDM-CMSCs. a–c Expressions of ALDH1A1, ALDH2, and ALDH3B1 were validated by real-time PCR with 10 Healthy- and 11 GDM-CMSCs samples. Gene expression levels were normalised to GAPDH and presented as fold change by comparing G-CMSCs to H-CMSCs using the 2^-(ΔΔCt) method. d ALDH activity colorimetric assay of ALDH enzymatic function in Healthy- and GDM-CMSCs. Results obtained from 6 independent experiments in duplicate. GDM-CMSCs showed reduced ALDH activity compared to Healthy-CMSCs. e Real-time PCR of Nrf2-mediated oxidative stress pathway genes; NQO1 and SOD2 were significantly reduced in GDM-CMSCs. Gene expression levels were normalised to GAPDH.f ROS production determined by DCFDA staining (green). Representative fluorescent images of the ROS level are shown from 3 independent experiments at different time points and imaged by confocal microscopy. Scale bar 100 μm. g Time-course measurement of ROS production measured by fluorescent intensity. The initial fluorescence intensity at 0 min was set at 100%. Results obtained from 6 independent experiments in triplicate. h, i H-CMSCs and GDM-CMSCs ALDH function inhibited by 100 mM DEAB. ALDH enzymatic functions were examined and ROS generation evaluated by DCFDA fluorescent intensity. All error bars in this figure are presented as mean ± SEM. Student's t test was used for statistical significance, *p < 0.05, **p < 0.01, ***p < 0.001
With impaired ALDH activity, the accumulation of highly reactive and toxic aldehyde tends to induce ROS formation and increase oxidative stress [[
To further elucidate the influence of ALDH activity on ROS regulation, the enzymatic function of ALDHs was suppressed by N,N-diethylaminobenzaldehyde (DEAB), a commonly used selective inhibitor of ALDHs. In the presence of the ALDH inhibitor, the ALDH activity was significantly suppressed in both H-CMSCs and GDM-CMSCs (Fig. 4h). Moreover, when the ALDH function was suppressed, the ROS production was significantly increased during glucose-induced metabolic process (Fig. 4i). DEAB pre-treated H-/GDM-CMSCs produced higher levels of ROS than un-treated H-/GDM-CMSCs. The finding confirmed the strong association between the ALDH function and cellular ROS regulation.
Low levels of ROS are detectable in many metabolic processes; however, when ROS production is in excess of the cellular antioxidant capacity, it contributes to cellular damage. We found that downregulation of Nrf2-mediated oxidative stress regulation pathway and the impaired function of detoxifying enzymes ALDHs resulted in an insufficient capacity to respond to increased oxidative stress in GDM-CMSCs.
DNA microarray data provides an understanding of gene profiles and biological functions altered in GDM-CMSCs offering a valuable resource to regenerative medicine development. To conclude from our findings, the uterine environment during pregnancy could impact on the biology of stem cells derived from perinatal tissues. GDM-CMSCs, compared to H-CMSCs, displayed an enhanced migration ability and a transcriptional profile indicating potential in epithelial development and skin formation and a putative role in wound repair. In contrast, ALDH detoxification enzymes were significantly reduced in GDM-CSMCs leading to downregulation of several degradation pathways. Decreased ALDH activity in GDM-CMSCs was also associated with an impaired ability to respond to oxidative stress. Taken together, these novel findings derived from microarray and associated functional assays can be useful for exploring suitable clinical uses of CMSCs from GDM and healthy pregnancies.
GDM-CMSCs had a number of upregulated genes involved in cell motility, cytoskeleton organisation, survival, epithelial development, and skin formation. The ability of transplanted cells to mobilise and migrate to injury sites would enable a direct role in tissue repair and regeneration [[
Dehydrated placental membrane has been used as a skin substitute for burned and ulcerated surfaces for many years [[
Pathways associated with several degradation processes were altered in GDM-CMSCs largely due to the significant reduction of ALDHs expression. As a critical detoxification enzyme, ALDHs are highly expressed in multiple embryonic tissues, stem cells, and progenitor cells [[
Developing therapeutic strategies using autologous MSCs requires a thorough understanding of their biological characteristics in vitro and in vivo. Although GDM animal models present multiple challenges due to their temporary disease condition and complex inducing factors, several studies have investigated biological properties of MSCs under type I and II diabetes mouse models. For instance, bone marrow MSCs derived from non-obese diabetic mice were found to produce high levels of proinflammatory cytokines, including IL-1α/β and MCP-1 [[
In summary, the progression of regenerative medicine and advanced cell banking technology provides an option for the use of perinatal tissue-derived autologous MSCs for personalised medicine. The effect of GDM on CMSC gene expression was evidenced by DNA microarray analysis coupled to functional assay identification of associated impaired and enhanced functions in GDM-MSCs. These data will assist in the identification and development of suitable applications of GDM-CMSCs and eventually transform the knowledge into clinical practice.
This work was funded by an ISTM/ACORN research grant from Keele University.
Not applicable.
All authors contributed to the experimental design. LC wrote the manuscript. LC and CTW acquired, analysed, and interpreted the data. NRF and PW supervised the study, interpreted the data, and revised the manuscript. All authors approved the final version of the manuscript.
All data generated and analysed during this study are available from the corresponding author.
Studies involving human placenta tissues were collected from Royal Stoke University Hospital, UK, and approved by the Solihull Research Ethics Committee, West Midlands (Reference 15/WM/0342). All women provided written informed consent.
Not applicable.
The authors declare that they have no competing interests.
Graph: Additional file 1: Figure S1. Enriched downstream cellular functions in "Physiological System Development and Function" in GDM-CMSCs.
Graph: Additional file 2: Figure S2. Validation of gene expression by real-time PCR.
Graph: Additional file 3: Figure S3. Wound healing assay.
• ALDH
- Aldehyde dehydrogenase
• BMP
- Bone morphogenetic proteins
• CD
- Cluster of differentiation
• CMSC
- Chorionic membrane-derived stem cell
• DCFDA
- 2′,7′-Dichlorofluorescin diacetate
• DEG
- Differentially expressed gene
• FGF
- Fibroblast growth factor
• GDM
- Gestational diabetes mellitus
• IL
- Interleukin
• IPA
- Ingenuity Pathway Analysis
• MSC
- Mesenchymal stem cell
• PCR
- Polymerase chain reaction
• ROS
- Reactive oxygen species
• STAT
- Signal transducer and activator of transcription
Supplementary information accompanies this paper at 10.1186/s13287-020-01828-y.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Liyun Chen; Chung-Teng Wang; Nicholas R. Forsyth and Pensee Wu
Reported by Author; Author; Author; Author