A natural product, resveratrol, protects against high-glucose-induced developmental damage in chicken embryo

Resveratrol, a famous plant-derived polyphenolic phytoalexin, has been considered to play physiological roles such as antioxidative, neuroprotective, and anticancer effects in adults. However, its antioxidative activity and neuroprotective effect were seldom discussed in the embryonic system. In this study, the effect of resveratrol on chicken embryo development under high glucose and its underlying mechanism of resveratrol were investigated. High glucose administrated to chicken embryo at embryonic Day 1 induced stillbirth, growth retardation, and impaired blood vessel development on yolk sac. However, resveratrol supplementation before glucose exposure showed significant effect on decreasing the death rate, developmental damage, and vessel injury. In addition, oxidative stress was caused by high-glucose exposure, and resveratrol could rescue this high-glucose-induced oxidative stress. Moreover, the neural developmental marker paired box 3 was significantly decreased by high glucose and recovered by resveratrol. Cell cycle-regulated gene expression was also intervened by resveratrol. This study had found an association between resveratrol and hyperglycemia-induced embryonic damage, which suggested a potential protective effect of resveratrol on gestational diabetes.

Keywords: high glucose; embryo development; antioxidation; resveratrol

Gestational diabetes mellitus (GDM) is currently defined as any degree of glucose intolerance with onset or first recognition during pregnancy [[1]]. GDM rate is increasing in recent years, affecting an estimated 6–7% of pregnancies in the USA, 8.14% in Asia, and 7.02% in Latin America [[2]]. A fetus with GDM after pregnancy may have a serious consequence like congenital malformations [[3]]. The situation emphasizes the urgent need for understanding the underlying mechanism of GDM-induced malformation. Researchers have found that free radicals, oxidative stress, and lipid peroxidation may be associated with diabetes-related pathology in adult systems [[5]], while studying high-glucose-induced oxidative stress in embryos is relatively new.

Resveratrol (trans-3,4′,5-trihydroxystilbene, C14H12O3, Figure 1) is a famous plant-derived polyphenolic phytoalexin for its antioxidative effect [[6]]. It is mainly found in the skin of grapes, raspberries, blueberries, and knotweed [[7]]. It has been reported to play many beneficial roles for health, including neuroprotective and cardioprotective, and improving insulin sensitivity and anticancer through antiproliferative and proapoptotic effects [9][10][11][12]. However, either its antioxidative activity or neuroprotective effect was discussed in the embryonic system.

Graph: Figure 1 Chemical structure of resveratrol.

In this study, chicken embryo was used to observe the high-glucose-induced embryonic developmental damage and investigate the effect of resveratrol on it. Different doses of resveratrol were administrated into the high-glucose-exposed chicken embryo. Then the protective effect of resveratrol was evaluated from the death and abnormality rate of embryos; weight and somite number of embryos; and the growth status of blood vessels. To explore the underlying mechanism by which resveratrol may exert, the antioxidant indexes were measured. Meanwhile, the embryo neural marker and cell cycle regulators were measured.

The effects of resveratrol on chicken embryonic development following high-glucose treatment were assayed at embryonic Day 5. High glucose caused severe deformities such as neural tube defects, anophthalmia, and scoliosis (Figure 2), while resveratrol supplement repaired these deformities (Figure 3(A)). As Figure 3 shows, high glucose significantly increased the rates of death and abnormalities in chicken embryos, while the positive antioxidant drug edaravone reduced these rates. As for resveratrol, rates of death and abnormalities were reduced after medium- and high-dose supplement (Figure 3(B),(C)). Developmental retardation, measured by embryo weight and somite number, was found in the high-glucose group. Medium and high doses of resveratrol supplement could significantly prevent the weight and somite number loss in chicken embryo (Figure 3(E),(F)).

Graph: Figure 2 High-glucose-exposed chicken embryo development. Gross morphology of chicken embryo at embryonic Day 5 after high-glucose exposure. (A) Control embryo, normal organs, including forebrain (FB), midbrain (MB), hindbrain (HB), optic organ (OP), heart (HT), forelimb bud (FBD), and hindlimb bud (HBD) of chicken embryo, were noticed. (B–D) High-glucose-induced abnormal chicken embryos.

Graph: Figure 3 Effects of resveratrol on high-glucose-exposed chicken embryo development. (A) Gross morphology of chicken embryo at embryonic Day 5. (B–C) Lethality and abnormality rate of high glucose on chicken embryo. Scale bar = 2 mm. (D) Weight of chicken embryos at embryonic Day 5. (E) Somite number at embryonic Day 2. Data are shown as mean ± SD and the significance of differences from normal control was at **p < 0.01, from high glucose at #p < 0.05, ##p < 0.01.

To investigate the effect of resveratrol and high glucose on vascular development, the status of blood vessels of yolk sac was observed. The results showed that high glucose caused abnormal angiogenesis, enlarged vessels, capillary occlusion, vessels atrophy, and dotted hemorrhage (Figure 4). However, supplement of resveratrol (medium dose) in advance can recover these damages to some degree. To quantify the high-glucose-induced vascular damage and the effect of resveratrol, the density of vessels of each group was calculated by Image-Pro Plus (IPP) software. A significant increase of vessel density in the high-glucose group as compared with the control group and decrease in the resveratrol group as compared with the high-glucose group were found (Figure 4(E)).

Graph: Figure 4 Effects of resveratrol on vessel development of chicken embryo. Vessel development on yolk sac was observed at embryonic Day 3.5. (A-C, A1-C1) Status of vessel development. Scale bar = 1 mm in A-C; scale bar = 0.5 mm in A1-C1. (D) General view of vessel positions observed. Vessel density was assayed by IPP software. (E) Vessel density was assayed by IPP software. Data are shown as mean ± SD and the significance of differences was from normal control at **p < 0.01, from high glucose at #p < 0.05.

The levels of reactive oxygen species (ROS) production and antioxidation ability of chicken embryo were measured at embryonic Day 3.5. High-glucose treatment significantly increased ROS generation, while resveratrol significantly decreased it (Figure 5(A)). Malondialdehyde (MDA) content, which was an indicator for lipid peroxidation induced by ROS, showed similar results (Figure 5(B)). The activities of free oxygen radical scavenging enzymes such as catalase (CAT), superoxide dismutase and glutathione peroxidase (GPX) were decreased in the high-glucose group and were recovered in the resveratrol group (Figure 5(C),(E)). In addition, Figure 5(F) shows that high-glucose administration caused significant increase of tissue glucose content. However, resveratrol supplement did not show significant changes as compared with the high-glucose group.

Graph: Figure 5 Effects of resveratrol on antioxidant indices. (A) ROS, (B) MDA, (C) CAT, (D) SOD, (E) GPX, and (F) tissue glucose contents were measured at embryonic Day 3.5. Data are shown as mean ± SD and the significance of differences was from normal control at **p < 0.01, from high glucose at #p < 0.05, ##p < 0.01.

The effect of high-glucose administration and resveratrol supplement on expression of paired box 3 (Pax3) protein, the crucial neural tube marker, was observed at embryonic Day 3.5. Results showed that high glucose caused significant decrease in Pax3 protein expression and resveratrol restored the expression (Figure 6(A)). On the other hand, the expression levels of p21, the cell cycle inhibitor, and cyclin D1, the cell cycle promoter, in embryos were evaluated in embryos to determine whether cell cycle dysregulation contributed to the reduction of cell proliferation and embryonic developmental delay. The p21 gene expression was significantly increased after high-glucose administration, while resveratrol reversed the increase (Figure 6(B)). The cyclin D1 gene expression was significantly decreased by high-glucose administration, whereas resveratrol reversed the increase (Figure 6(C)).

Graph: Figure 6 Effects of resveratrol on Pax3 expression and regulators of the cell cycle. (A) Expression of Pax3 protein measured by Western blot. (B, C) Expression of p21 and cyclin D1 gene measured by qPCR. Data are shown as mean ± SD and the significance of differences was from normal control at **p < 0.01, from high glucose at #p < 0.05, ##p < 0.01.

This study investigated the effect of resveratrol supplementation on the high-glucose-induced developmental damage in chicken embryo. High glucose could reduce the weight of embryos and also induce embryo malformations of the nervous system, such as neural tube defects [[13]]. However, resveratrol could dose-dependently protect these malformations. Since embryo is sensitive to environment, the high dose (10 nmol/egg), which was exceeded than the optimal dose, might exert a toxic overdose effect. The medium dose (1 nmol/egg) of resveratrol showed best effect in this study. Resveratrol offered significant protection against high-glucose-induced embryonic weight loss. As far as is known, this study is the first to demonstrate the embryo-protective effect of resveratrol in high-glucose-treated chick embryo.

On the other hand, researchers have demonstrated the link between diabetes and microangiopathy. Diabetic microangiopathies, such as enlarged vessels, capillary occlusion, vessels atrophy, and dotted hemorrhage [[14]], were also found in the high-glucose group. Also, abnormal angiogenesis was found in chicken embryos after high glucose and the density of vessels was significantly increased. The reverse result of resveratrol supplement on high-glucose-induced microangiopathy [[15]] further confirmed the protective effect of resveratrol on this model.

The embryo is exceptionally vulnerable to oxidative damage and its antioxidant defense system is not yet well developed [[16]]. Oxidative stress was found in the high-glucose-treated embryos while resveratrol supplementation dose-dependently abrogated the high-glucose-associated alterations in oxidative stress parameters of the embryos. In this study, the protective effect of resveratrol was evident in the embryonic milieu as reflected by the significant reduction in ROS and MDA concentrations. Furthermore, resveratrol was able to restore the antioxidant enzyme activities in embryos. Although resveratrol only marginally reduced the glucose concentrations in the body, it offset high-glucose-induced oxidative stress to a larger extent, indicating that the antioxidant effect of resveratrol may be largely responsible for the ameliorative effects.

Previous studies suggested that Pax3 proteins could regulate the neural tube and neural crest formation. In this study, Pax3 protein expression was down-regulated in the high-glucose-treated chick embryo. This phenomenon indicated that resveratrol protected these malformations through antioxidative stress and modulated the protein expression of Pax3. On the other side, regulators of the cell cycle were altered in chicken embryos following high-glucose treatment, while resveratrol reversed the alteration. When chicken embryos were exposed to high-glucose environment, embryonic cells may have been arrested in the G1 phase because of the suppression of cyclin D1 and the up-regulation of p21 [[17]], which would lead to a reduction of embryonic cell proliferation. We can suspect that the effect of resveratrol may also be related to its activity on these regulators.

In this study, a new model was developed using chicken embryo to mimic the high-glucose-induced embryo malformation and assess the effect of resveratrol on it. It was shown that oxidative stress may be a critical mechanism by which high glucose exerts its teratogenic effect. Meanwhile, the protective effect of resveratrol on the high-glucose-induced damage may be related to its remarkable antioxidant activity. In conclusion, the effect of resveratrol offered a new strategy and revealed the possibility of using antioxidant for the prevention of the diabetes-associated damage on the embryonic development.

Fertilized eggs were incubated in an incubator (Grumbach, Wetzlar, Germany) at 37°C and 65–75% relative humidity. Before incubation, embryos were divided into six groups (n = 20), which were control, model (high glucose, 0.4 mmol/egg, according to Scott-Drechsel et al. [[18]]), antioxidant control (edaravone, 0.1 nmol/egg), and three dosages of resveratrol (Jianfeng, Jinhua, China, ≥ 98% purity) groups (low, 0.1 nmol/egg; medium, 1 nmol/egg; and high, 10 nmol/egg). Resveratrol and edaravone were dissolved in 100 μl chicken saline (0.72% NaCl) and administrated into the air space before incubation. Glucose was dissolved in 200 μl chicken saline and injected after 24 h of incubation. All embryos were further incubated to the required embryo development day.

At embryonic Day 5, the chicken embryos were sampled from each group to assess the development outcome. Rates of death and rates of abnormality were recorded (vs. survived embryos). Living embryos were removed from their eggs for body weights assessment. Somite numbers were calculated at embryonic Day 2 under an anatomical lens. The developmental status of blood vessel on the yolk sac at embryonic Day 3.5 was photographed using a stereo-microscope (Olympus MVX10, Olympus, Tokyo, Japan).

Glucose concentrations were measured in the homogenates of embryos at embryonic Day 3.5 using a glucose oxidase-coupled spectrophotometric assay kit (Sigma Chemical Co., St Louis, MO, USA). Peroxide content in embryos was determined by measuring thiobarbituric acid-reactive substances with a commercial MDA kit (Nanjing Jiancheng, Nanjing, China). ROS generation ratio was detected with 2′,7′-dichlorofluorescein-diacetate (DCFH-DA, Sigma Chemical Co.). Then 1 μl DCFH-DA was added into 100 μl homogenates and then measured at an excitation/emission wavelength pair of 485/535 nm using TECAN GENios Luciferase microplate reader (TECAN, Männedorf, Switzerland) at 37°C. The activities of total SOD, CAT, and GPX were measured according to the guide of commercial kits (Nanjing Jiancheng).

Total RNA was extracted from the embryos using TRIzol reagent according to the protocol of the manufacturer (Takara, Tokyo, Japan). Total RNA (3 μg) was reversely transcribed into cDNA at 42°C for 1 h in 20 μl of reaction mixture containing reverse transcriptase with oligo (dT)15 primer (Tiangen, Beijing, China). Then the cDNA was determined using MaximaTM SYBR Green/Fluorescein quantitative polymerase chain reaction (qPCR) master mix (Fermentas, St Leon-Rot, Germany) via the IQTM5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The final products were analyzed by the 2− ΔΔCt method. Pax3, forward primer: TAACCATGGTGGTGTGCCTC, reverse primer: GTGGTGCTATAGGTCGGTGG; PPIA, forward primer: TGACAAGGTGCCCATAACAG, reverse primer: TTCTCGTCGGCAA-ACTTCTC.

Embryos on EDD 3.5 were homogenized in Radio Immunoprecipitation Assay (RIPA) buffer, electrophoresed on Sodium dodecyl sulfonate-polyacrylamide gelelectrophoresis (SDS-PAGE) gels, and transferred to Polyvinylidene fluoride (PVDF). Blocking was carried out using 5% Bull Serum Albumin (BSA) in Tris Buffered Saline Tween (TBST) for 1 h at room temperature. Subsequently, blots were incubated with primary monoclonal anti-Pax3 (Developmental Studies Hybridoma Bank, Iowa City, IA, USA, 1:1000) antibodies overnight at 4°C. Then the proteins were visualized using anti-mouse IgG secondary antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA, 1:2000) conjugated with horseradish peroxidase (HRP) and Pierce ECL Western Blotting Substrate (Thermo Scientific, Hudson, NH, USA) as the substrate of HRP.

Experimental values are given as means ± standard deviation (SD). Statistical analysis of the data was performed using the SPSS 18.0 statistical software. One-way analysis of variance was applied to analyze for difference in data of biochemical parameters among the different groups, followed by Dunnett's significant post-hoc test for pairwise multiple comparisons. Differences were considered as statistically significant at p < 0.05.

The authors Rui-Rong Tan and Shi-Jie Zhang equally contributed to this work.

The authors declare that there is no conflict of interest.