A20 serves as a critical brake on NF-κB-dependent inflammation. In humans, polymorphisms in or near the TNFAIP3/A20 gene have been linked to various inflammatory disorders, including systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA). Experimental gene knockout studies in mice have confirmed A20 as a susceptibility gene for SLE and RA. Here, we examine the significance of protein citrullination and NET formation in the autoimmune pathology of A20 mutant mice because autoimmunity directed against citrullinated antigens released by neutrophil extracellular traps (NETs) is central to the pathogenesis of RA and SLE. Furthermore, genetic variants impairing the deubiquitinase (DUB) function of A20 have been shown to contribute to autoimmune susceptibility. Our findings demonstrate that genetic disruption of A20 DUB function in A20 C103R knockin mice does not result in autoimmune pathology. Moreover, we show that PAD4 deficiency, which abolishes protein citrullination and NET formation, does not prevent the development of autoimmunity in A20 deficient mice. Collectively, these findings provide experimental confirmation that PAD4-dependent protein citrullination and NET formation do not serve as pathogenic mechanisms in the development of RA and SLE pathology in mice with A20 mutations.
These authors contributed equally: Karel F. A. Van Damme and Pieter Hertens.
The anti-inflammatory protein A20 (also known as Tumor Necrosis Factor alpha-induced protein 3, TNFAIP3) acts as a key player in the termination of NF-κB signaling. A20 also protects cells from death, independently of NF-κB regulation[
In a recent study, Odqvist et al. proposed a mechanism suggesting that increased PAD4-dependent protein citrullination and neutrophil extracellular trap (NET) formation contribute to the development of anti-cyclic citrullinated peptide (anti-CCP) antibodies and autoimmune pathology in RA and SLE patients with A20 DUB-domain mutations[
Here, we aimed to investigate the in vivo significance of PAD4-dependent protein citrullination and NET formation in the autoimmune pathology of A20 mutant mice.
Polymorphisms in TNFAIP3, the gene encoding A20, are among the most frequently reported risk alleles in RA and SLE [
To address the functional consequence of an A20 DUB inactivation in the development of autoimmunity in vivo, we generated a knock-in mouse line mutated in the deubiquitinase function of A20 by substituting the active site cysteine (C) residue with an arginine (R) (A20
Graph: Figure 1A20 DUB mutation does not induce NET formation or autoimmune pathology. (A) Generation of A20 C103R knockin mutation in mice using CRISPR/Cas9 technology. A20 domain structure with indication of C103R mutation in OTU deubiquitinase (DUB) domain (upper). Sanger sequencing of wild-type (+ / +), heterozygous (C103R/ +) and homozygous (C103R/C103R) clone (lower). Structural analysis of A20 DUB carrying the C103R mutation (pink, C103R), and comparison with the wildtype A20 DUB structure (cyan, C103) versus acetamidylated A20 DUB at C103 (cyan, C103ace). (B, C) Body weight (B) and spleen weight (C) of 25–30 week old wild-type (A20 +/+), A20 C103R/+ and A20 C103R/C103R mice. Each dot represents one mouse. Data are expressed as mean ± s.e.m. (D) Total IgA, IgM, IgG, anti-cardiolipin-IgA, and anti-dsDNA-IgG and neutrophil extracellular trap (NET) concentrations in serum of 25–30-week old mice. (E–F) Histological images of haematoxylin and eosin-stained (E) and PAS-stained (F) kidney sections of 25–30-week old mice, showing normal glomerular architecture and cellularity, and absence of granulomas, tubulo-interstitial atrophy, or vascular changes. Scalebar, 50 µm. (G) Histological scores for mice with the indicated genotypes (25–30 weeks). The arthritis was scored at the Achilles tendon (infiltrate) and the synovio-entheseal complex (SEC, exudate), each ranging from 0 (normal) to 3 (severely inflamed). Dots in the graphs indicate individual mice and data are expressed as mean ± s.e.m. (H) Histological images of haematoxylin and eosin-stained ankle joints of mice with the indicated genotypes. No signs of an arthritis-like phenotype can be observed in A20 C103R/C103R mice. Pictures are representative for 4–5 biologically independent mice for each genotype. Scalebar, 1000 µm. (I) Neutrophil Extracellular Traps (NETs) in serum of wild-type (A20 +/+), A20 C103R/+ and A20 C103R/C103R mice. Each dot represents one mouse. Data are expressed as mean ± s.e.m. n.s., non-significant.
Bone marrow-derived macrophages (BMDMs) from A20
Homozygous A20
Finally, no increased neutrophil extracellular trap (NET) formation or upregulated expression of PAD4 by neutrophils could be observed in A20
A20 has previously been demonstrated to regulate dendritic cell (DC) activation to maintain immune homeostasis. Consequently, mice with DC-specific A20 knockout develop a severe inflammatory pathology reminiscent of SLE[
DC-specific A20 knockout mice (A20
Graph: Figure 2PAD4 deficiency does not rescue DC-specific A20 deficient mice from developing SLE pathology. (A) Breeding scheme to generate A20DC-KO and A20DC-KOPadi4−/− mice. (B, C) Body weight (B) and spleen weight (C) of 25–30 week old wild-type, A20DC-KO , Padi4−/− and A20DC-KOPadi4−/− mice. Each dot represents one mouse. Data are expressed as mean ± s.e.m. (D) Serum levels of TNF, IL-6, IL-22 and BAFF in indicated genotypes. (E) Quantitative PCR results for interferon-stimulated genes on whole spleen of mice with indicated genotypes. (F) Serum auto-antibody concentrations on ELISA in mice with indicated genotypes. (G) Representative immunofluorescent image of glomerular IgA deposition per genotype. White dotted circles indicate the glomeruli. (H) Quantification of the glomerular mean fluorescent signal for IgA. (I) Representative hematoxylin and eosin-stained kidneys of mice with the indicated genotypes, showing extensive perivascular infiltrates in both A20DC-KO and A20DC-KOPadi4−/− mice. Each dot represents one mouse. Data are expressed as mean. Each dot represents a biologically independent mouse. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Scalebar, 50 µm. CNRQ = Calibrated Normalized Relative Quantity. Results are representative of two independent experiments.
Together, these data demonstrate that protein citrullination and NET formation do not serve as pathogenic mechanisms driving SLE pathology in DC A20-deficient mice.
A20 deficiency in myeloid cells leads to spontaneous development of a severe and destructive polyarthritis with many features of RA[
Graph: Figure 3PAD4 deficiency does not rescue myeloid-specific A20 deficient mice from developing RA pathology. (A) Breeding scheme to generate A20myel-KO and A20myel-KOPadi4−/− mice. (B) Spleen weight of 25–30 week old wild-type, A20myel-KO , Padi4−/− and A20myel-KOPadi4−/− mice, with representative picture. Each dot represents one mouse. Data are expressed as mean ± s.e.m. (C) Biweekly clinical arthritis scores of the ankles of wild-type, A20myel-KO , Padi4−/− and A20myel-KOPadi4−/− mice. Data are expressed as mean ± s.e.m. *** p < 0.001 (REML analysis). (D) Graphs depicting histological scores for mice with the indicated genotypes (25–30 weeks). The arthritis was scored at the Achilles tendon (infiltrate) and the synovio-entheseal complex (SEC, exudate), each ranging from 0 (normal) to 3 (severely inflamed). Total arthritis score is the sum of the 3 individual scores. Dots in the graphs indicate individual mice and data are expressed as mean ± s.e.m. (E) Histological images of hematoxylin and eosin-stained ankle joints of mice with the indicated genotypes, demonstrating periarticular inflammation and infiltration of mononuclear cells (insert), as well as the infiltrate in the SEC (dashed insert) in A20myel-KO and A20myel-KOPadi4−/− mice. Pictures are representative for 4–5 biologically independent mice for each genotype. Scalebar, 1000 µm. (F) Levels of IL-6, TNF and IL-18 in serum of wild-type, A20myel-KO , Padi4−/− and A20myel-KOPadi4−/− mice. Each dot represents a biologically independent mouse. * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. (G) Line Immunoassay (LIA) of 25-week-old wild-type, A20myel-KO , Padi4−/− and A20myel-KOPadi4−/− mice. Each lane represents an individual mouse. (H) Neutrophil Extracellular Traps (NETs) in serum of wild-type, A20myel-KO , Padi4−/− and A20myel-KOPadi4−/− mice. Each dot represents a biologically independent mouse. n.s., non-significant.
Finally, to more specifically address the potential role of A20 in neutrophils, we crossed A20 floxed mice with Mrp8-Cre[
Together, these data demonstrate that protein citrullination and NET formation do not serve as pathogenic mechanisms driving RA pathology in myeloid A20-deficient mice.
The presence of increased protein citrullination and extracellular trap formation has been suggested as a possible explanation for the development of autoimmunity in individuals with defective A20 DUB function[
Our findings provide compelling evidence that loss of A20 DUB activity has minimal consequences, does not induce NETosis or give rise to SLE or RA pathology. Neither the previously published C103A mouse lines[
In previous studies, we provided evidence that A20-deficient macrophages undergo necroptosis, mediated by RIPK1, RIPK3 and MLKL, leading to NLRP3 inflammasome activation and RA development in myeloid-specific A20 deficient mice[
Conditional A20/Tnfaip3 knockout mice, in which exons IV and V of the Tnfaip3 gene are flanked by two LoxP sites, were generated as described before[
Bone marrow was flushed from mouse femurs and tibia with ice-cold sterile RPMI medium, and cultured in Roswell Park Memorial Institute 1640 medium supplemented with 40 ng/mL recombinant mouse macrophage colony-stimulating factor (M-CSF) (VIB Protein Core), 10% fetal calf serum, L-glutamine (200 mM) and 1% penicillin/streptomycin at 37 °C and 5% CO2. Fresh M-CSF was added on day 3 and medium was refreshed on day 5. On day 7 cells were seeded at 1 × 10
Bone marrow cells were flushed from mouse tibia and fibula with ice-cold sterile RPMI medium over a 70 µm cell strainer. Following centrifugation (1240 rpm for 4 min at room temperature), red blood cells were lysed by incubation with NaCl solution (0.2% NaCl:1.2% NaCl, 4:11). Cells were spun down (1240 rpm for 5 min at room temperature), resuspended in PBS and slowly added on top of a 62% Percoll (cells:Percoll, 1:1) (Percoll TM: Cytiva, cat nr. 17089101). Density gradient centrifugation was performed (2500 rpm for 28 min at room temperature), and the lower neutrophil containing fraction was washed with PBS and spun down (1240 rpm for 4 min at room temperature). Pellets were resuspended in RPMI.
Spleens were cut into small pieces and digested at 37 °C for 30' in RPMI containing 1% fetal bovine serum, 20 µg/mL Liberase TM (Roche) and 10 U/mL DNAse I (Roche). Following digestion, cells were passed through a 70 µm filter. Osmotic lysis buffer was added on ice for 3 min to remove erythrocytes. This digest was resuspended and 5% of the cells were used for further processing. Counting beads (eBioscience cat. 01-1234-42) were added and the cells were stained with fluorescently labeled antibodies and Fc block during 30 min at 4 °C. Antibodies used : Anti-mouse CD11b monoclonal antibody (rat, clone M1/70, BD Biosciences, 563553), Anti-mouse Ly-6G monoclonal antibody (rat, clone 1A8, BD Biosciences, 612921), Anti-mouse CD26 monoclonal antibody (rat, clone H194-112, BD Biosciences, 741729), Anti-mouse Ly-6C monoclonal antibody (rat, clone HK1.4, eBioscience, 48-5932-82), Anti-mouse CD45 monoclonal antibody (rat, clone 30-F11, BioLegend, 103138), Anti-mouse XCR1 monoclonal antibody (mouse, clone ZET, BioLegend, 148220), Anti-mouse CD64 monoclonal antibody (mouse, clone X54-5/7.1, BioLegend, 139311), Anti-mouse F4/80 monoclonal antibody (rat, clone BM8, BioLegend, 123141), Anti-mouse MerTK monoclonal antibody (rat, clone 2B10C42, BioLegend, 151504), Anti-mouse I-A/I-E monoclonal antibody (rat, clone M5/114.15.2, BioLegend, 107626), Anti-mouse CD88 monoclonal antibody (rat, clone 20/70, BioLegend, 135806), Anti-mouse CD11c monoclonal antibody (Armenian hamster, clone N418, eBioscience, 61-0114-82), Anti-mouse CD19 monoclonal antibody (rat, clone 1D3), eBioscience, 15-0193-83), Anti-mouse CD3 monoclonal antibody (Armenian hamster, clone 145-2C11, eBioscience, 15-0031-83), Anti-mouse Ter119 monoclonal antibody (rat, clone TER119, eBioscience, 15-5921-82), Anti-mouse NK1.1 monoclonal antibody (mouse, clone PK136, BioLegend, 108716), Anti-mouse CD172a monoclonal antibody (rat, clone P84, BioLegend, 144008), Anti-mouse 120G8 monoclonal antibody (rat, clone 120-G8, produced in house), Fixable Viability Dye eFluor780, eBioscience, 65-0865-14), Anti-mouse TCR delta monoclonal antibody (Armenian hamster, clone GL3, BD Biosciences, 553177), Anti-mouse CD8a monoclonal antibody (rat, clone 53–6.7, eBioscience, 45-0081-82), Anti-mouse CD62L monoclonal antibody (rat, clone MEL-14, eBioscience, 11-0621-85), Anti-mouse CD44 monoclonal antibody (rat, clone IM7, BioLegend, 103049), Anti-mouse CD4 monoclonal antibody (rat, clone RM4-5, eBioscience, 170042-83), Anti-mouse CD3 monoclonal antibody (Armenian hamster, clone 145-2C11, eBioscience, 12-0031-82), Anti-mouse CD45R monoclonal antibody (rat, clone RA3-6B2, BD Biosciences, 563708), Anti-mouse CD19 monoclonal antibody (rat, clone 1D3, BD Biosciences, 563333), Anti-mouse GL7 monoclonal antibody (rat, clone GL7, BioLegend, 144606), Anti-mouse CD95 monoclonal antibody (hamster, clone Jo2, BD Biosciences, 557653). All samples were measured on a BD LSRFortessa. Downstream analysis was performed in Flowjo (BD).
Mice were randomly scored in a blinded fashion for development of peripheral arthritis. The severity of arthritis was assessed using a visual scoring system.
Paraffin sections of paws were made at 7 µm thickness and stained with haematoxylin and eosin for evaluation of inflammation and bone erosion. Histological scores were based on evaluation of four parameters, at the Achilles tendon (infiltrate), the synovio-entheseal complex (exudate), the talus-tibia-calcaneus (exudate), and calcaneal erosion, each ranging from 0 (normal) to 3 (severely inflamed). Paraffin sections of kidney were made at 3 µm thickness, and of colon, spleen and liver at 5 µm thickness and stained with haematoxylin and eosin or periodic acid-Schiff (PAS).
Specific ANA were detected by line immunoassay (INNO-LIA ANA Update, Innogenetics NV). The nylon strips were incubated with serum at a 1:200 dilution. Following washing, a 1:2500 dilution of an alkaline phosphatase-conjugated anti-mouse IgG was added (Chemicon). After washing, the reaction was revealed with the chromogen 5-bromo-4-chloro-3-indolyl phosphate, producing a dark brown color in proportion to the amount of specific autoantibody in the test sample. Sulfuric acid was added to stop the color development. The assay contains the following recombinant and natural antigens: SmB, SmD, RNP-A, RNP-C, RNP-70 k, Ro52/SSA, Ro60/SSA, La/SSB, CenpB, Topo-I/Scl70, Jo-1, ribosomal P, and histones. Alternatively, mouse anti-dsDNA IgG or IgA were quantified on ELISA (Alpha Diagnostic Intl., cat. 5120) according to the manufacturers' instructions. For the measurement of anti-cardiolipin antibodies, microplates were coated with 50 µg/mL cardiolipin from bovine heart (Sigma, cat. C1649) in 100% ethanol. Following overnight incubation at room temperature, plates were blocked with 1% bovine serum albumin in PBS. After serum incubation for 2 h, HRP-labeled goat anti-mouse IgG or IgA (Southern Biotech cat. 1030-05 and 1040-05 resp.) was added for 1 h and detected by TMB (eBioscience cat 00-4201-56). The absorbance for each sample was measured at 450 and 650 nm.
Cytokine levels in culture medium were determined by magnetic bead-based multiplex assay using Luminex technology (Bio-Rad) according to the manufacturers' instructions. Alternatively, mouse IL-6 (Invitrogen cat. 88-7064) and TNF (Invitrogen cat. 88-7324) were measured by ELISA, according to the manufacturer's instructions. B-cell activating factor (BAFF) was quantified on ELISA (R&D cat DY2106-05) according the manufacturer's instructions. Neutrophil extracellular traps (NETs) were detected by ELISA (Merck cat. 11774425001) according to the manufacturers' instructions.
Cells were directly lysed in 2 × Laemmli or first lysed in RIPA lysis buffer (50 mM Tris–HCl pH 7.6, 1 mM EDTA, 150 mM NaCl, 1% NP40, 0.5% sodiumdeoxycholate, 0.1% SDS) buffer, followed by denaturation in 1 × Laemmli buffer (5% β-mercaptoethanol, 100 mM Tris–HCl (pH 6.8), 10% glycerol, 2% SDS and bromophenol blue) and boiled for 5 min. Lysates were separated by SDS polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes with a semi-dry blot system (Invitrogen), and immunoblotted with anti-A20 (Santa Cruz, sc-166692), anti-IκBα (Santa Cruz Biotechnology, Inc., sc-371), anti-phospho-IκBα (Cell Signaling, CST9246), anti-p38 (cell signaling, CST9212), anti-phospho-p38 (cell signaling, CST9215), anti-SAPK/JNK (cell signaling, CST9252), anti-phospho-SAPK/JNK (cell signaling, CST4668), anti-PAD4 (Abcam, Ab214810), and anti-β-actin (Santa Cruz Biotechnology, Inc., sc-47778) antibodies.
The kidneys were freshly frozen in OCT (Sakura, 4583) and stored at −80 °C. Cryosections of 10 to 20 µm thickness were fixed for 2 to 10' in 2% PFA at room temperature. For immunoglobulin detection, sections were blocked for 60' with 1% goat and 1% rat serum. Following washing, anti-mouse IgA monoclonal antibody (rat, clone C10-3, FITC conjugated, BD Biosciences, #559354) and DAPI (ThermoFisher, D21490) were added for 2 h. For neutrophil extracellular trap (NET) imaging, tissues were blocked in 2% BSA (Sigma-Aldrich) and 3% Donkey serum for 60' at room temperature. Tissues were stained overnight at 4 °C with antibodies against myeloperoxidase (R&D, AF3667-SP) and cit-H3 (Abcam, ab5103), and then washed three times for 30' in total. Tissues were then stained with secondary antibodies against goat or rabbit for 1 h at room temperature, and then stained with DAPI (ThermoFisher, D21490) for 15 min. Slides were mounted with polyvinyl alcohol (Sigma, 10981), and imaged on a laser scanning microscope (Zeiss LSM-780, immunoglobulin detection) or a slide scanner (Zeiss Axioscan, NET imaging). For the immunoglobulin detection, quantification of fluorescent intensity was carried out in ImageJ. The Z stacks were compressed at maximal intensity, the glomerular area were manually marked and the mean fluorescent intensity was measured per glomerular area for each fluorophore. The mean of 3 to 5 representative glomeruli per mouse was plotted.
Whole spleen was homogenized with a TissueLyser (Qiagen) and further processed for RNA extraction using TRIzol Reagent (Invitrogen cat. 10296-010) according to the manufacturer's instructions. RNA content was measured on a NanoDrop Spectrophotometer (Thermo Scientific) and 1 µg RNA was transferred for cDNA conversion using the sensiFAST cDNA synthesis kit (Bioline cat. 65054). cDNA of interest was amplified by 30 cycles of PCR with sensiFAST SYBR No-ROX kit (Bioline cat. 98050) on a LightCycler 480 system (Roche). The following primers were used: target genes Isg15 (GGTGTCCGTGACTAACTCCAT, TGGAAAGGGTAAGACCGTCCT), Isg20 (GAACATCCAGAACAACTGGCG, GTAGAGCTCCATTGTGGCCCT), Rsad2 (GGTGCCTGAATCTAACCAGAAG, CCACGCCAACATCCAGAATA) and reference genes TBP (TCTACCGTGAATCTTGGCTGTAAA, TTCTCATGATGACTGCAGCAAA), HPRT (TCCTCCTCAGACCGCTTT, CCTGGTTCATCATCGCTAATC). Analysis was carried out in qbase + (Biogazelle) and Calibrated Normalized Relative Quantities (CNRQs) values were exported.
The crystal structure of human A20 (pdb code 3DKB[
GraphPad Prism V8 software was used for statistical analysis. Results are expressed as the mean ± SEM or mean ± SD, as indicated in figure legend. Statistical significance between experimental groups was assessed using a nonparametric Mann–Whitney U-statistical test. Statistical significance between multiple groups was assessed using either one- or two-way ANOVA with Tukey or Sidak correction for multiple comparison. Comparison of two or more groups over time was analyzed as longitudinal data (repeated measurements over time) using the residual maximum likelihood (REML) as implemented in Genstat v.19.
All animal experiments were carried out in accordance with relevant guidelines and regulations, as described by the ARRIVE guidelines. The Ethical committee of The Faculty of Sciences of Ghent University approved all the animal experiments.
The G. van Loo lab is supported by the Vlaams Instituut voor Biotechnologie (VIB) and by research grants from the FWO (G090322N, G026520N, G012618N, EOS-G0H2522N-40007505), the Charcot Foundation, the "Belgian Foundation against Cancer", and by a research grant from FOREUM Foundation for Research in Rheumatology. G. van Loo and M. Lamkanfi are supported by the Research Council of Ghent University (BOF23/GOA/001). M. Lamkanfi is additionally supported by research grants from the FWO (GOI5722N, G017121N, G014221N) and ERC (ERC-2022-PoC 101101075). K. Van Damme has received a personal PhD fellowship from FWO Flanders. A. Martens was supported by a postdoctoral fellowship of FWO. D.E. is supported by the Vlaams Instituut voor Biotechnologie (VIB) and by research grants from the FWO, EU-IMI, the Research Council of Ghent University and a research grant from the FOREUM Foundation for Research in Rheumatology. S.N.S. is supported by the Vlaams Instituut voor Biotechnologie (VIB) and by research grants from the FWO (G049820N, G0H1222N, S000722N, S002322N). B.N.L. is supported by a European Research Council Advanced Grant (ERC-2017-ADG-789384) and several FWO grants, as well as a Ghent University Methusalem Grant. K. Van Damme and Bart N. Lambrecht are supported by a Lupus Innovation Award by the Lupus Research Alliance.
K.V.D., P.H. and G.v.L. conceived the study and designed the experiments. K.V.D., P.H., A.M., E.G., D.P., I.B., A.F., J.D., H.A., A.W., E.H. and L.V.W. performed and/or analysed the experiments. T.H. generated A20-C103R and PAD4 knockout mice. K.V.D., P.H., M.L., S.N.S., D.E., B.N.L. and G.v.L. supervised the experiments and interpreted the data. K.V.D and G.v.L. wrote the paper.
All data supporting the findings of this study are available within the paper and its Supplementary Information.
The authors declare no competing interests.
Graph: Supplementary Information 1.
Graph: Supplementary Information 2.
The online version contains supplementary material available at https://doi.org/10.1038/s41598-023-45324-8.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Karel F. A. Van Damme; Pieter Hertens; Arne Martens; Elisabeth Gilis; Dario Priem; Inge Bruggeman; Amelie Fossoul; Jozefien Declercq; Helena Aegerter; Andy Wullaert; Tino Hochepied; Esther Hoste; Lieselotte Vande Walle; Mohamed Lamkanfi; Savvas N. Savvides; Dirk Elewaut; Bart N. Lambrecht and Geert van Loo
Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author