BackgroundStaphylococcus haemolyticus has emerged as an important multidrug-resistant nosocomial pathogen. Linezolid is useful in the treatment of severe infections caused by methicillin-resistant Staphylococci. Resistance to linezolid in Staphylococci is due to one or more of the following mechanisms: acquisition of the cfr (chloramphenicol florfenicol resistance) gene, mutation in the central loop of domain V of the 23S rRNA, and mutation in the rplC and rplD genes. This study was carried out to detect and characterize resistance to linezolid among the clinical isolates of Staphylococcus haemolyticus. Materials and Methods The study included 84 clinical isolates of Staphylococcus haemolyticus. Susceptibility to various antibiotics was determined by disc diffusion method. Minimum inhibitory concentration (MIC) was determined by agar dilution method for linezolid. Methicillin resistance was screened using oxacillin and cefoxitin disc. Polymerase chain reaction was done to detect mecA, cfr and mutations in the V domain of the 23S rRNA gene. Results Resistance to linezolid was exhibited by 3 of the 84 study isolates with MIC more than 128 µg/mL. The cfr gene was detected in all the three isolates. The G2603T mutation was observed in the domain V of the 23S rRNA among two isolates, whereas one isolate lacked any mutation. Conclusion The emergence and spread of linezolid-resistant Staphylococcus haemolyticus isolates carrying G2603T mutation in the domain V of the 23S rRNA and harboring the cfr gene pose a threat in clinical practice.
Keywords: linezolid resistance; cfr gene; 23S rRNA gene; Staphylococcus haemolyticus
Staphylococcus haemolyticus is an opportunistic bacterial pathogen that colonizes human skin and mucous membrane. It is the second most common coagulase-negative Staphylococci (CONS) isolated from clinical specimens and is associated with bloodstream infections related to intravascular catheters, skin and soft tissue infection, meningitis, endocarditis, and a variety of device-associated infections. [
Linezolid is a synthetic bacteriostatic drug, belonging to oxazolidinone class of antibiotics and is active against various multidrug-resistant gram-positive pathogens, such as methicillin-resistant Staphylococci and vancomycin-resistant Enterococci. Linezolid inhibits protein synthesis by interacting with the 23S rRNA in the 50S ribosomal subunit. [
A year after its introduction, the first clinical linezolid-resistant Staphylococcus aureus strain appeared in 2001 and thereafter few reports were published from the United States and Europe. [
This study was undertaken to detect and characterize resistance to linezolid among clinical isolates of Staphylococcus haemolyticus.
The study was conducted in a 1,600-bedded, university teaching hospital in South India. A total of 84 clinically significant, consecutive, nonrepetitive Staphylococcus haemolyticus isolated during the period 2019 to 2021 were included in the study. The study was approved by Institutional Ethics Committee (REF: IEC-NI/19/FEB/68/12)
The source of the isolates was blood (n = 36), exudative specimens (n = 38), and urine (n = 10). The isolates were identified up to species level by standard biochemical tests and automated systems: VITEK2 GP-card (bioMerieux, Marcy l'Etoile, France) and MALDI-TOF MS (bioMerieux, Marcy l'Etoile, France).
Antibiotic susceptibility testing was done by Kirby Bauer disc diffusion method for different classes of antimicrobial agents such as ampicillin (10 µg), cefuroxime (30 µg), erythromycin (30 µg), clindamycin (2 µg), amikacin (30 µg), ciprofloxacin (5 µg), linezolid (30 µg), and teicoplanin (30 µg). Methicillin resistance was detected by cefoxitin (30µg) and oxacillin (1µg) disc (Himedia, Mumbai, Maharashtra, India) as per Clinical and Laboratory Standards Institute (CLSI 2019) guidelines (CLSI-M100-S29). [
Colonies of clinical strains were transferred to sterile distilled water. The samples were then boiled to prepare the DNA template. This was used as template for polymerase chain reaction (PCR).
All the isolates were subjected to molecular confirmation using the species specific nuc gene. [
The primers used are described in Table 1. Previously, characterized strains were used as positive controls. Sterile Mili Q water was used as negative controls.
Table 1 Primers and PCR conditions used for resistance genes
Gene Primer PCR conditions Amplicon References 23s rRNA F- CGGCGGCCGTAACTATAACGR- CAGCACTTATCCCGTCCATAC Initial denaturation: 95°C for 3 minDenaturation: 95°C for 30 sAnnealing: 55°C for 30 sExtension: 72°C for 30 s for 30 cyclesFinal extension: 5 min at 72°C 846 2 F- TAGTGGTAGGCGTATTAGCCR- ACGATATTTGCCATTCGGTG Initial denaturation: 94°C for 3 minDenaturation: 94°C for 30 sAnnealing: 50°C for 30 sExtension: 72°C for 45 s for 30 cyclesFinal extension: 7 min at 72°C 434 10 F- GTAGAAATGACTGAACGTCCGATAR- CCAATTCCACATTGTTTCGGTCTAA Initial denaturation: 94°C for 3 minDenaturation: 94°C for 30 sAnnealing: 50°C for 30 sExtension: 72°C for 45 s for 30 cyclesFinal extension: 7 min at 72°C 310 11 F-TGAAGTATAAAGCAGGTTGGGAGTR- ACCATATAATTGACCACAAGCAGC Initial denaturation: 94°C for 2 minDenaturation: 94°C for 10 sAnnealing: 55°C for 30 sExtension: 72°C for 30 s for 30 cyclesFinal extension: 7 min at 72°C 746 12
1 Abbreviation: PCR, polymerase chain reaction.
The obtained sequences were compared to the reference 23S rRNA gene sequences of Staphylococcus haemolyticus (JCSC1435). The sequences were submitted to GenBank database with the following accession numbers OL691912, OL691913, OL743221, OL743222, ON249039, ON249040.
The medical records were perused to collect the clinical details of the patients from whom the LRSH was isolated.
Among the 84 isolates, the nuc gene was present in all the isolates, confirming the identification as Staphylococcus haemolyticus. The resistance exhibited to various classes of antimicrobials is as follows: ampicillin 95.2% (80/84), cefuroxime 79% (66/84), cefoxitin 79% (66/84), cefotaxime 79% (66/84), erythromycin 88% (74/84), clindamycin 57% (48/84), ciprofloxacin 72.6% (61/84), and linezolid 3.5% (3/84). All isolates were susceptible to vancomycin and teicoplanin.
Methicillin resistance was detected by oxacillin and cefoxitin disc diffusion method. Resistance to oxacillin was observed in 67/84 and resistance to cefoxitin was detected in 66/84 of the study isolates. The mecA gene was present in 98.5% (66/67) of the oxacillin-resistant isolates.
The linezolid-resistant isolates (n = 3) had MIC of greater than 128 µg/mL. Cfr gene was detected in all the three linezolid-resistant isolates. The domain V of the 23S rRNA gene was amplified by PCR. The obtained sequences were compared to the reference 23S rRNA gene sequences of Staphylococcus haemolyticus (JCSC1435). The BLAST alignment revealed G2603T point mutation in the domain V of 23S rRNA gene in two of the linezolid-resistant isolates.
The clinical details of the patient from whom LRSH was isolated are tabulated in Table 2.
Table 2 Clinical profile, molecular characterization among the LRSH
Characteristics Patient I Patient II Patient III Isolate number E7710 MS7890 GE920 Age/Sex 71/Female 65/Male 69/Male Hospital location ICU ICU ICU Admitting speciality General surgery General medicine General surgery Date of isolation 26/08/2019 26/11/2020 11/03/2021 Underlying disease/diagnosis Diabetic footMicrocytic hypochromic anemia Septic encephalopathy Diabetic foot ulcerAcute pyelonephritis Co-morbid conditions Diabetes mellitus Diabetes mellitus Diabetes mellitus Days in hospital 9 days 9 days 19 days Surgical procedures Ray amputation Wound debridement Ray amputation Antimicrobials used prior to detection of linezolid resistance Amoxicillin/clavulanate Amoxicillin/clavulanate, azithromycin Ciprofloxacin, levofloxacin, cefoperazone–sulbactam Indwelling devices Peripheral line Peripheral line Peripheral line Outcome Recovered Discharged against medical advice Recovered Source specimen Pus Pus Pus MIC (µg/mL) > 128 > 128 > 128 mecA + + + cfr + + + 23s rRNA mutations in V domain G2603T Nil G2603T
2 Abbreviations: ICU, intensive care unit; LRSH, linezolid-resistant Staphylococcus haemolyticus; MIC, minimum inhibitory concentration.
Staphylococcus haemolyticus is increasingly recognized as an important pathogen due to its ability to develop multiple drug resistance, its adaptability and ability to survive in the hospital environment, especially on medical devices. [
Resistance to linezolid in Staphylococci is due to one or more of the following mechanisms: acquisition of the cfr (chloramphenicol florfenicol resistance) gene, mutation in the central loop of domain V of the 23S rRNA, and mutation in the rplC and rplD genes, which encodes for the 50S ribosomal proteins L3 and L4, respectively. [
In this study, linezolid resistance was detected in three isolates and their MIC was greater than 128 µg/mL. All the three isolates carried the cfr gene and among them the mutation in the domain V of 23S rRNA was detected in two isolates. The BLAST alignment revealed a novel G2603T point mutation in the domain V of 23S rRNA gene in two of the linezolid-resistant isolates. The G2603T mutation has not been reported previously in India. The G2603T mutation has been reported in China among Staphylococcus epidermidis , Staphylococcus capitis[
Table 3 Mutations reported in the domain V of 23S rRNA encoding for linezolid resistance in Staphylococcus haemolyticus
Mutation Year Country Reference G2576T 2012 Brazil 17 G2576T 2013 Spain 5 G2576T 2014 India 6 G2603T 2014 Brazil 15 G2576T 2014 USA 18 G2447U U2504A C2534U G2576T 2016 India 19 G2614T 2019 India 13 G2447U 2019 India 20 C2534U G2576T 2019 India 21 G2576T 2020 India 22 G2603T 2022 India This study
Following its first detection in 2001, sporadic cases of linezolid resistance have been reported globally. In India, the first case report on LRSH from North India was published in 2011 [
A study from Vietnam carried out whole genome sequencing and demonstrated the transferability of the plasmid carrying the cfr gene. [
This study reports dual mechanisms of resistance to linezolid. Although the mutational resistance to linezolid poses a threat in clinical practice, the acquisition of the cfr gene is threatening because of its potency for horizontal transmission between species. Only one isolate carried the cfr gene alone and lacked any mutations, which is similar to the observations made in previous studies. [
In this study, of the three patients who had infection with LRSH, two patients underwent wound debridement and ray amputation for removal of nidus of infection and source control. Though these patients were treated with beta lactam antibiotics and fluoroquinolone, they recovered and were discharged from the hospital. It may be reasonably assumed that Staphylococcus haemolyticus could have been a colonizer in the wound and the recovery may be attributed to source control. Follow-up was lost in one patient.
Since many CONS are usually considered as part of normal skin flora, most clinical laboratories do not test for antimicrobial susceptibility unless from a sterile site such as blood. These organisms have relatively low virulence but are now increasingly recognized as clinically significant. As the pathogenic significance becomes apparent, it becomes necessary to characterize them and study their antimicrobial susceptibility profile. [
The presence of cfr gene along with mutations is alarming. Prudent use of linezolid and strengthening implementation of infection control measures and screening of patients with linezolid resistant-CONS should be mandated to curtail the spread of resistance and preserve the drug.
By Rhea Michelle J. Khodabux; Shanthi Mariappan and Uma Sekar
Reported by Author; Author; Author