Background: Effective identification and development of new molecular methods for the diagnosis, treatment and prognosis of lung adenocarcinoma (LUAD) remains an urgent clinical need. DNA methylation patterns at cytosine bases in the genome are closely related to gene expression, and abnormal DNA methylation is frequently observed in various cancers. The ten-eleven translocation (TET) enzymes oxidize 5-methylcytosine (5mC) and promote locus-specific DNA methylation reversal. This study aimed to explore the role of the TET2 protein and its downstream effector, 5-hmC/5-mC DNA modification, in LUAD progression. Methods: The expression of TET2 was analysed by real-time PCR, Western blotting and immunohistochemistry. The 5-hmC DNA content was determined by a colorimetric kit. Activation of the cGAS-STING signalling pathway was evaluated by Western blotting. CCK-8, wound healing and Transwell assays were performed to evaluate the effect of TET2 on cell proliferation, migration and invasion abilities. A xenograft model was used to analyse the effect of TET2 on the tumorigenic ability of A549 cells. Results: TET2 overexpression decreased proliferation and metastasis of A549 and H1975 cells in vitro and in vivo. However, TET2 knockdown dramatically enhanced the proliferation, migration and invasion of A549 and H1975 cells. Mechanistically, activation of the cGAS-STING signalling pathway is critical for the TET2-mediated suppression of LUAD cell tumorigenesis and metastasis. Conclusion: In this study, we demonstrate a tumour suppressor role of TET2 in LUAD, providing new potential molecular therapeutic targets and clinical therapies for patients with non-small cell lung cancer.
Keywords: TET2; DNA hydroxymethylation; 5hmC; cGAS-STING signaling; Non-Small Cell Lung Cancer
Supplementary Information The online version contains supplementary material available at https://doi.org/10.1186/s12885-023-11343-x.
Lung cancer, including non-small cell lung cancer and small cell lung cancer, is the leading cause of cancer-related deaths worldwide [[
DNA methylation patterns at cytosine bases in the genome are closely related to gene expression, and abnormal DNA methylation is frequently observed in diseases [[
The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway has emerged as a critical innate immune pathway that, following engagement by DNA, promotes distinct immune responses [[
In this study, we demonstrate that TET2-mediated DNA hydroxymethylation inhibits the proliferation and metastasis of lung cancer cells in vitro and in vivo. Moreover, we found that cGAS-STING signalling activation is critical for TET2-mediated inhibition of cell proliferation and metastasis in LUAD.
A total of 60 LUAD tissues and matched adjacent normal tissues collected at the Third Affiliated Hospital of Soochow University between 2015 and 2018 were obtained. The clinicopathological characteristics of the 60 LUAD patients were presented in Table 1. Tissue samples were obtained during lung resection surgery and stored in liquid nitrogen at -80 °C. This study was approved by the Ethics Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China; No. 2,023,054). All patients gave informed consent.
Table 1 The clinicopathological characteristics of the 60 LUAD patients
Characteristic Whole cohort Gender Male 35 Female 25 Age [years; median (range)] 62 (37.0–75.0) Histological grade G1 8 G2 34 G3 18 Tumor stage T1 31 T2 22 T3 4 T4 3 Nodal stage N0 37 N1 13 N2 8 2 Metastasis stage M0 58 M1 2 Clinical stage (AJCC 8th) I 27 II 18 III 15
All cells in this study were obtained from the Chinese Academy of Sciences, Shanghai Institutes for Biological Sciences. HEK293 cells and A549 and H1975 LUAD cells were cultured in DMEM supplemented with 10% foetal bovine serum (FBS).
Full-length human TET2 cDNA was inserted into the pLVX-Ires-Puro vector (Clontech) to construct the TET2 overexpression plasmid. The siRNA targeting TET2 was purchased from Genelily BioTech Co., Ltd (Shanghai, China). To establish individual stable call lines, lentiviruses were used. After transfection of lentiviral vectors into HEK293 cells for 72 h, lentiviral particles in the cell culture supernatant were collected. A549 and H1975 cells were then infected with these lentiviral particles. The stably transfected cells were identified by screening with puromycin (2 µg/mL) for 1 week beginning 48 h after lentiviral infection.
The cell proliferation assay was performed using a Cell Counting Kit-8 (CCK-8) (Dojindo, Japan) in accordance with the manufacturer's instructions. Cells (1 × 10
The invasiveness of cells was evaluated by the Martrigel (BD Bioscience)-coated Transwell (Corning Inc.). Cells (1 × 10
The cell migration ability was measured by a wound healing assay. A total of 10
Total RNA was extracted using TRIzol according to the manufacturer's instructions. First-strand cDNA was synthesized using upper standard II (Invitrogen), using 1 µg total RNA for each cDNA synthesis reaction. Real-time PCR was performed using SYBR Green Universal Master Mix (Roche) and a primer mixture. GAPDH was used as the internal reference for mRNA expression. The primers used for real-time qPCR were presented in Table 2.
Table 2 The sequence of the primers used in real-time PCR.
Genes Forwards Primer (5'-3') Reverse Primer (5'-3') TET2 GCCACTACCACACCACCACC GCATCGGAGAAGGGCTGCAT cGAS CAGAAAAAGAGCGCCCCGGA TCTTGGCTTCGTGGAGCAGC STING GCCACCCCCTTGCAGACTTT CCTGGTAGGCAATGAGGCGG TBK1 CAACCTGGAAGCGGCAGAGT GCGTCTGCCAGTGATCCACC GAPDH CACCATCTTCCAGGAGCGAG AAATGAGCCCCAGCCTTCTC
Total protein was extracted and separated on SDS-PAGE gels. Antibodies specific for TET2 (1:2000), cGAS (1:1000), STING (1:1000), and TBK1 (1:1500) (all from ABclonal, Shanghai, China) were used. An anti-GAPDH antibody (Kancheng Biotechnology, 1:5000) was used as a loading control.
BALB/c nude mice (5 weeks of age) were purchased from SLAC Animal Center in Shanghai, China, for xenograft model establishment. Animal experiments were approved by the Animal Care Use Committee of the Third Affiliated Hospital of Soochow University. A total of 10
All experiments were repeated three times using independent cell cultures. GraphPad Prism 8.0 was used for statistical analysis. The data in all figures are expressed as the means ± SEMs. Student's t test and two-way ANOVA were used to confirm that the differences were statistically significant. Overall survival was analysed by the Kaplan‒Meier method with the log-rank test. For all statistical tests, a significance level of less than 0.05 (two-tailed) was accepted as statistically significant.
To understand the potential role of TET2 expression and TET2-mediated 5-hmC modification in LUAD, we first analysed the differences in TET2 expression and 5-hmC levels between adjacent normal tissues and tumours in 60 paired samples. Immunohistochemical staining and quantitative analysis of the data showed that TET2 protein levels were clearly lower in human lung cancer tissues than in normal adjacent lung tissues (P < 0.01, Fig. 1A). Consistent with this finding, the content of 5-hmC-modified DNA detected by the Global 5-hmC DNA Quantification Kit was lower in human lung cancer tissues than in normal adjacent lung tissues (P < 0.01, Fig. 1B), and this finding was further verified by dot blotting in 8 paired adjacent normal tissues and tumour tissues (Fig. 1C). Pearson correlation assay showed a positive correlation between TET2 and 5-hmC levels (Fig. 1D). Moreover, the prognostic correlation between the 5-hmC/TET2 levels and survival in lung cancer patients was analysed. Kaplan–Meier analysis indicated that lower 5-hmC levels were highly correlated with shorter overall survival times (P < 0.05, Fig. 1E). These results demonstrate that the levels of TET2 expression and TET2-mediated 5-hmC modification are decreased in lung cancer tissues.
Graph: Fig. 1TET2 expression and TET2-mediated 5-hmC modification levels were significantly reduced in lung cancer tissues. (A) Immunohistochemical determination of TET2 protein expression levels in lung cancer and adjacent tissues; (B) Colorimetric assay to measure 5-hmC levels in lung cancer tissues and adjacent tissues; (C) The level of 5-hmC in lung cancer tissues and adjacent tissues was determined by dot blotting; (D) The correlation between the 5-hmC and TET2 level in lung cancer tissues; (E)The correlation between the 5-hmC and TET2 level with the prognosis of patients; ** P < 0.01 versus indicated group
To evaluate the role of TET2 in the biological behaviours of LUAD cells, we generated two LUAD cell lines (A549 and H1975) with stable TET2 overexpression. The overexpression efficiency was analysed by real-time PCR (Fig. 2A) and verified by Western blotting (Fig. 2B). The 5-hmC-modified DNA levels were significantly elevated by TET2 overexpression in the A549 and H1975 cell lines (Fig. 2C). TET2 overexpression dramatically inhibited the proliferation (Fig. 2D), migration (Fig. 2E) and invasion (Fig. 2F) of A549 and H1975 cells, as determined by CCK-8, wound healing and Transwell assays, respectively. In addition, we generated two TET2 knockdown cell lines (A549 and H1975). The knockdown efficiency was confirmed by real-time PCR (Fig. 3A) and Western blotting (Fig. 3B). Consistent with the above findings, the 5-hmC-modified DNA levels were significantly decreased by TET2 knockdown in A549 and H1975 cells (Fig. 3C). TET2 knockdown significantly promoted the proliferation (Fig. 3D), migration (Fig. 3E) and invasion (Fig. 3F) of A549 and H1975 cells. These results suggest a tumour suppressor role of TET2 in LUAD.
Graph: Fig. 2TET2 overexpression significantly inhibited the proliferation, migration and invasion of lung cancer cells. (A) Real-time PCR was used to verify the overexpression efficiency of TET2 in A549 and H1975 lung cancer cells; (B) Western blotting was used to verify the overexpression efficiency of TET2 in A549 and H1975 lung cancer cells; (C) Colorimetric verification of the effect of TET2 overexpression on 5-hmC levels in A549 and H1975 lung cancer cells; (D) The effect of TET2 overexpression on the proliferation of A549 and H1975 lung cancer cells was analysed by CCK-8 assay; (E) The effect of TET2 overexpression on the migration of A549 and H1975 lung cancer cells was analysed by a wound healing assay; (F) The effect of TET2 overexpression on the invasion ability of A549 and H1975 lung cancer cells was evaluated by a Transwell assay. * P < 0.05, ** P < 0.01,*** P < 0.001 versus indicated group
Graph: Fig. 3Downregulation of TET2 significantly enhanced the proliferation, migration and invasion of lung cancer cells. (A) Real-time PCR validation of the knockdown efficiency of TET2 in A549 and H1975 lung cancer cells; (B) Western blotting was used to verify the knockdown efficiency of TET2 in A549 and H1975 lung cancer cells; (C) Colorimetric verification of the effect of TET2 knockdown on 5-hmC levels in A549 and H1975 lung cancer cells; (D) The effect of TET2 knockdown on the proliferation of A549 and H1975 lung cancer cells was analysed by a CCK-8 assay; (E) The effect of TET2 knockdown on the migration of A549 and H1975 lung cancer cells was analysed by a wound healing assay; (F) The effect of TET2 knockdown on the invasion ability of A549 and H1975 lung cancer cells was evaluated by a Transwell assay. * P < 0.05, ** P < 0.01 versus indicated group
To further explore the regulatory mechanism of TET2 in LUAD, we analysed dysregulated transcription in TET2-overexpressing A549 cell lines and normal vector control cell lines using RNA sequencing. We found dramatically elevated expression of cGAS-STING signalling molecules, including cGAS, STING and TBK1, as shown in the heatmap (Fig. 4A). The elevated expression of cGAS, STING and TBK1 was verified by real-time PCR (Fig. 4B) and Western blotting (Fig. 4C). Consistently, TET2 knockdown significantly decreased the expression level of cGAS, STING and TBK1 in A549 cells (Fig. 4B and C).
Graph: Fig. 4TET2 significantly activates the cGAS-STING signalling pathway. (A) RNA-seq analysis was performed, and the heatmap indicates the influence of TET2 overexpression on the expression levels of cGAS-STING signalling pathway-related genes (STING, cGAS, TBK1, IRF3 and IRF7) in A549 cells; (B) The effect of TET2 overexpression and knockdown on the mRNA expression levels of cGAS-STING signalling pathway-related genes (cGAS, STING and TBK1) in A549 cells was verified by real-time PCR; (C) Western blotting was used to verify the effect of TET2 overexpression and knockdown on the protein expression levels of cGAS-STING signalling pathway-related genes (cGAS, STING and TBK1) in A549 cells. * P < 0.05, ** P < 0.01 versus indicated group
To identify the contribution of cGAS-STING signalling to the TET2-medicated inhibition of lung cancer cell proliferation, migration and invasion, we then treated the vector control and TET2-overexpressing A549 and H1975 cell lines with the cGAS-STING signalling inhibitor RU.521 (10 µM). The elevated levels of 5-hmC-modified DNA in the TET2-overexpressing A549 and H1975 cell lines were unchanged by RU.521 treatment (Fig. 5A), whereas the activity of cGAS-STING signalling was clearly suppressed by RU.521 treatment (Fig. 5B). On the other hand, RU.521 treatment showed no effect on proliferation (Fig. 5C and D), migration (Fig. 5E) or invasion (Fig. 5F) of the vector control A549 and H1975 cell lines. However, TET2-mediated inhibition of proliferation (Fig. 5C and D), migration (Fig. 5E) and invasion (Fig. 5F) was clearly reversed by RU.521 treatment. These results demonstrate that TET2 impairs the proliferation, migration and invasion of lung cancer cells via activation of the cGAS-STING signalling pathway in vitro.
Graph: Fig. 5Inhibition of the cGAS-STING signalling pathway significantly reversed the inhibitory effect of TET2 overexpression on the proliferation, migration and invasion of lung cancer cells. (A) Colorimetric verification of the effects of the cGAS-STING signalling pathway inhibitor RU.521 and TET2 overexpression on 5-hmC levels and (B) the activity of the cGAS-STING signalling pathway in A549 and H1975 lung cancer cells; (C) The effects of the cGAS-STING signalling pathway inhibitor RU.521 and TET2 overexpression on the proliferation of A549 and (D) H1975 lung cancer cells were evaluated by a CCK-8 assay. (E) The effects of the cGAS-STING signalling pathway inhibitor RU.521 and TET2 overexpression on the migration ability of A549 and H1975 lung cancer cells were evaluated by a wound healing assay; (F) A Transwell assay was performed to evaluate the effects of the cGAS-STING signalling pathway inhibitor RU.521 and TET2 overexpression on the invasion ability of A549 and H1975 lung cancer cells. * P < 0.05, ** P < 0.01 versus indicated group
To further confirm the critical role of cGAS-STING signalling in TET2-mediated inhibition of lung cancer cell proliferation and metastasis in vivo, we generated a subcutaneous xenograft model in BALB/c NOD mice (n = 5 group) using vector control and TET2 overexpression cells. The mice were intraperitoneally injected with a cGAS-STING inhibitor (RU.521, 5 mg/kg) or normal saline every 5 days after assessment of the tumour volume. Clearly, the tumours derived from TET2-overexpressing A549 cells were smaller than those derived from the vector control A549 cells (Fig. 6A). Similar results were observed for the tumour volume (Fig. 6B) and tumour weight (Fig. 6C). The TET2-mediated increase in the 5-hmC-modified DNA level was unchanged by RU.521 treatment (Fig. 6D), whereas the activity of cGAS-STING signalling was dramatically suppressed by RU.521 treatment (Fig. 6E). Consistent with this finding, RU.521 treatment did not alter tumour growth in the vector control group, whereas it significantly increased tumour volume (Fig. 6B) and tumour weight (Fig. 6C) in the TET2 overexpression group. IHC staining further showed increased protein levels of TET2, cGAS, STING and TBK1 in TET2-overexpressing tumours, in which the protein levels of STING and TBK1 were clearly decreased by RU.521 treatment (Fig. 6F).
Graph: Fig. 6TET2 impairs the tumorigenesis of lung cancer cells via activation of the cGAS-STING signalling pathway in vivo. (A) Representation of lung cancer tumours generated by subcutaneous implantation of A549 cells in BALB/c NOD mice; (B) Tumour volume and growth were analysed; (C) Tumour weight was analysed; (D) Colorimetric quantification was used to verify the effect of TET2 overexpression on the 5-hmC level and (E) the activity of the cGAS-STING signalling pathway during tumour formation from A549 cells in nude mice; (F) Differences in the protein levels of TET2, cGAS, STING and TBK1 were verified by immunohistochemistry. * P < 0.05, ** P < 0.01 versus indicated group
We also used these cells to generate a mouse xenograft model of tumour metastasis via tail vein injection of A549 cells into BALB/c NOD mice (n = 5 group). The mice were also intraperitoneally injected with a cGAS-STING inhibitor (RU.521, 5 mg/kg) or normal saline every 5 days. Approximately 2 weeks after cell injection, the mice were sacrificed, and the lung metastatic lesions (Fig. 7A) were counted. The number of lung metastatic lesions in the TET2 overexpression group was significantly less than that in the vector control group, and, similar to the results described above, lung metastasis was reversed by RU.521 treatment (Fig. 7B). Consistent with this finding, the TET2-mediated increase in the 5-hmC-modified DNA level in lung metastatic lesions was unchanged by RU.521 treatment (Fig. 7C), whereas the activity of cGAS-STING signalling was significantly suppressed by RU.521 treatment (Fig. 7D). Moreover, IHC staining showed increased protein levels of TET2, cGAS, STING and TBK1 in TET2-overexpressing tumours, in which the protein levels of STING and TBK1 were clearly decreased by RU.521 treatment (Fig. 7E). Collectively, these results demonstrate that TET2 inhibits the tumorigenesis and metastasis of LUAD cells via activation of the cGAS-STING signalling pathway in vivo.
Graph: Fig. 7TET2 impairs the metastasis of lung cancer cells via activation of the cGAS-STING signalling pathway in vivo. (A) Lung cancer metastatic lesions were generated by tail vein injection of A549 cells in BALB/c NOD mice; (B) The number of lung metastatic lesions; (C) Colorimetric quantification was used to verify the effect of TET2 overexpression on the 5-hmC level and (D) the activity of the cGAS-STING signalling pathway in lung metastatic lesions formed from A549 cells in nude mice; (E) Differences in the protein levels of TET2, cGAS, STING and TBK1 were verified by immunohistochemistry. * P < 0.05, ** P < 0.01,*** P < 0.001 versus indicated group
Previous studies have shown that reduced expression of the TET protein and reduced levels of 5-hmC are common features of gastric cancer, prostate cancer, liver cancer, lung cancer, breast cancer, glioblastoma, melanoma and other cancers [[
The physiological correlation of TET protein expression with development was studied in a knockout mouse model. In mutant mice with defects in both TET1 and TET2, it was noted that while some mice were able to survive and develop normally, most died during the perinatal period and showed a wide range of defects, including anencephaly, growth retardation, and haemorrhage [[
Cyclic GMP-AMP synthase (cGAS) interferon gene (STING) signalling induces the expression of type I interferons (IFNs) and other inflammatory cytokines to activate the antibacterial innate immune defence in response to detection of viral and bacterial DNA [[
This study reveals a tumour suppressor role of TET2 in LUAD. TET2 overexpression in A549 and H1975 cells decreased their proliferation and metastasis. In contrast, TET2 knockdown dramatically enhanced the proliferation, migration and invasion of A549 and H1975 cells. Mechanistically, activation of the cGAS-STING signalling pathway is critical for TET2-mediated suppression of the tumorigenesis and metastasis of lung cancer cells. The results of this study provide new potential molecular therapeutic targets and clinical therapies for patients with LUAD.
The authors would like to thank all staff and volunteers who contributed to this study.
Gui Cheng, Changping Wu and Jingting Jiang conceived and designed the experiments, analysed the data, and prepared figures and tables. Data collection was performed by Jun Wu, Mei Ji and Wenwei Hu. The first draft of the manuscript was written by Gui Cheng, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
This research project was supported by the National Natural Science Foundation of China (NSFC) (82072561), Youth Talent Science and Technology Project of Changzhou Health Commission (QN202201).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
The authors declare no competing interests.
All animal studies were approved by the Animal Use and Care Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China; No. 2023054). The authors confirmed that all animal experiments were performed in accordance with ARRIVE guidelines (https://arriveguidelines.org). Also, the experiments with human tissues was also approved by the Ethics Committee of the Third Affiliated Hospital of Soochow University (Changzhou, China; No. 2023054). All the methods/study was in accordance with the declaration of Helsinki, and all methods were conducted in accordance with relevant guidelines and regulations. The human tissues from all subjects were obtained with informed consents.
Not applicable.
Below is the link to the electronic supplementary material.
Graph: Supplementary Material 1
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
By Gui Cheng; Jun Wu; Mei Ji; Wenwei Hu; Changping Wu and Jingting Jiang
Reported by Author; Author; Author; Author; Author; Author