Genome-wide identification and evolutionary analysis of the AP2/EREBP, COX and LTP genes in Zea mays L. under drought stress
AP2 (APETALA2)/EREBP (ethylene-responsive element-binding protein), cytochrome c oxidase (COX) and nonspecific lipid transfer proteins (LTP) play important roles in the response to drought stress. This is the first study to identify the COX gene in Zea mays L. via genome-wide analysis. The qRT‒PCR results indicated that AP2/EREBP, COX and LTP were downregulated, with fold changes of 0.84, 0.53 and 0.31, respectively, after 12 h of drought stress. Genome-wide analysis identified 78 AP2/EREBP, 6 COX and 10 LTP genes in Z. mays L. Domain analysis confirmed the presence of the AP2 domain, Cyt_c_Oxidase_Vb domain and nsLTP1 in the AP2/EREBP, COX and LTP proteins, respectively. The AP2/EREBP protein family (AP2) includes five different domain types: the AP2/ERF domain, the EREBP-like factor (EREBP), the ethylene responsive factor (ERF), the dehydration responsive element binding protein (DREB) and the SHN SHINE. Synteny analysis of the AP2/EREBP, COX and LTP genes revealed collinearity orthologous relationships in O. sativa, H. vulgare and A. thaliana. AP2/EREBP genes were found on the 10 chromosomes of Z. mays L. COX genes were found on chromosomes 1, 3, 4, 5, 7 and 8. LTP genes were found on chromosomes 1, 3, 6, 8, 9 and 10. In the present study, the Ka/Ks ratios of the AP2/EREBP paralogous pairs indicated that the AP2/EREBP genes were influenced primarily by purifying selection, which indicated that the AP2/EREBP genes received strong environmental pressure during evolution. The Ka/Ks ratios of the COX-3/COX-4 paralogous pairs indicate that the COX-3/COX-4 genes were influenced primarily by Darwinian selection (driving change). For the LTP genes, the Ka/Ks ratios of the LTP-1/LTP-10, LTP-5/LTP-3 and LTP-4/LTP-8 paralogous pairs indicate that these genes were influenced primarily by purifying selection, while the Ka/Ks ratios of the LTP-2/LTP-6 paralogous pairs indicate that these genes were influenced primarily by Darwinian selection. The duplication time of the AP2/EREBP paralogous gene pairs in Z. mays L. ranged from approximately 9.364 to 100.935 Mya. The duplication time of the COX-3/COX-4 paralogous gene pair was approximately 5.217 Mya. The duplication time of the LTP paralogous gene pairs ranged from approximately 19.064 to 96.477 Mya. The major focus of research is to identify the genes that are responsible for drought stress tolerance to improve maize for drought stress tolerance. The results of the present study will improve the understanding of the functions of the AP2/EREBP, COX and LTP genes in response to drought stress.
Keywords: AP2/EREBP; COX; LTP; Genome-wide identification; Evolutionary analysis; Drought stress
Introduction
Drought is defined as dryness (lack of water, moisture deficit, shortage of precipitation) for a period of time that affects organisms (plants, animals, humans) in the affected area[1]–[4]. Drought is the most destructive type of hydrological hazard[5]. The development of drought-tolerant seed varieties can help farmers produce crops under drought stress. In maize (Z. mays L.), drought stress is one of the major environmental stress effects on yield reduction, and drought can affect maize at any stage of development. Breeding programmes are used to improve the drought tolerance of maize hybrids. Molecular biology techniques were used to improve breeding efficiency by identifying genes related to drought stress[6]. Climate changes such as water scarcity have negative effects on plant growth and yield production[7]. Crop plants are exposed to several types of environmental stress, which affects their growth and development throughout their life cycle. Drought activates gene expression pathways in plants to protect cells against water deficit[8]. APETALA2 (AP2)/ethylene-responsive element-binding protein (EREBP) is a transcription factor that has essential regulatory functions for protecting plants during stress. AP2/EREBP is one of the largest transcription factor families in plants[9]–[11]. AP2s/EREPs are involved in regulating gene expression during abiotic stress[12] and plant growth and development[11],[13]. The AP2/EREBP protein family is classified into: the APETALA2 (AP2), ethylene-responsive factor (ERF), dehydration-responsive element binding protein (DREB), and related to ABI3/VP1 (RAV). In cotton (Gossypium raimondii), the genes are distributed on all chromosomes. In Gossypium hirsutum, the ERF and DREB genes play important roles in stress responses[11]. GhERF12 protein play crucial roles in organ development and differentiation in G. hirsutum[14]. Cytochrome c oxidase (COX) catalyzes the transfer of electrons from reduced cytochrome c (CYTc) to the final acceptor O2 to H2O for ATP production[15],[16]. Restriction mapping and DNA sequencing were used to study the functional relationships of the COX mitochondrial genes. The results did not reveal a transcript of cox1; rather, a reduced level of a cox2 transcript and two different cox3 transcripts were detected. Results indicate that genomic rearrangements of the both 5' and 3' flanking regions of the cox1 gene leads to impaired of cox1 transcription[17]. The nonspecific lipid transfer protein (LTPs) are involved in different biological processes and play key roles in plant[18]. LTP2 play critical role for abiotic[19] and biotic stresses tolerance in plants[20]. LTPs are a large protein family present in all plants and are expressed in many different tissues. LTPs play important roles in signaling via their structure, which contains a N-terminal signal peptide that delivers proteins to the plasma membrane[21]. In maize, LTPs are differentially regulated by drought and salt treatments[22]. In rice, the expression of LTP is strongly induced under drought and salinity stresses[23]. In wheat, TaLTP1.2 and TaLTP1.13 are upregulated during drought[24]. In Lotus japonica, The LjLTP genes are expressed in aerial tissues under drought stress[25]. In the Moss Physcomitrium (Physcomitrella) patens, the expression of 8 LTPgs was investigated during several abiotic stresses. Three LTPg genes are significantly upregulated, which leads to the downregulation of the PpLTPg genes[26].
Methods
Identification of the AP2/EREBP, COX and LTP genes in Z. mays L.
The genomes of Z. mays L., Oryza sativa, Hordeum vulgare and Arabidopsis thaliana were downloaded from the Phytozome database[27]. The AP2/EREBP (accession number: NP_001183842.1), COX (accession number: NP_001288395.1) and LTP (accession number: ABA33850.1) proteins were used as query proteins from the NCBI database (https://www.ncbi.nlm.nih.gov/)[28] (Sheet 1 Online Resource SI 1) to screen AP2/EREBP, COX and LTP protein members in the genomes of Z. mays L. from the Phytozome database (https://phytozome.jgi.doe.gov)[27] with an E-value ≤ 1e-30 and ≥ 50% identity for AP2/EREBP proteins (https://phytozome-next.jgi.doe.gov/blast-results/694644), whereas the Phytozome database parameters for COX proteins (https://phytozome-next.jgi.doe.gov/blast-results/694640) and LTP proteins (https://phytozome-next.jgi.doe.gov/blast-results/694645) had an E-value ≤ 1e−30.
Characterization of the AP2/EREBP, COX and LTP proteins in Z. mays L.
Circoletto (http://tools.bat.infspire.org/circoletto/)[29] visualized the sequence identity of the AP2/EREBP, COX and LTP proteins. The physical and chemical properties of the AP2/EREBP, COX and LTP proteins, including the molecular weight, isoelectric point, total number of negatively charged residues, total number of atoms, instability and grand average hydropathicity (GRAVY), were computed using the ExPASy ProtParam Tool[30].
Phylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the AP2...
Multiple sequence alignments of the AP2/EREBP, COX and LTP proteins from Z. mays L. were performed via the MUSCLE method. Molecular evolutionary genetic analysis (MEGA-11)[31] was subsequently conducted on a phylogenetic tree with a maximum likelihood of 1000 bootstrap replicates based on the WAG with Freqs. (+ F) Model. The Itools online website[32] was used to modify and visualize the tree.
According to the position information of the AP2/EREBP, COX and LTP genes on the chromosome, a karyotype map of the AP2/EREBP, COX and LTP genes was drawn using TBtools[33]. The output image was used to show all the AP2/EREBP, COX and LTP genes on the chromosome.
The rates of synonymous (Ks) and nonsynonymous (Ka) substitutions were calculated by TBtools[33] to investigate selection pressure. The divergence time of the gene pairs was estimated using the synonymous mutation rate of substitutions per synonymous site per million years ago (Mya) as follows: "T = Ks/2λ", with a λ value of 6.05 × 10−9[34].
The duplicated genes were identified as paralogous if the alignment covered ≥ 70% of the longer gene and if the identity of the aligned region was ≥ 70%[35]; additionally, the genes were identified by the MEGA-11[31] gene duplication wizard. Paralogous gene pair (tandem and segmental genes) collinearity analysis was visualized as a Circos plot through TBtools[33].
TBtools[33] were used to determine the syntenic relationships of the AP2/EREBP, COX and LTP genes in Z. mays L. against O. sativa, H. vulgare and A. thaliana.
Conserved domain, conserved motif, gene structure and Promoter analyses of the AP2/EREBP, COX...
The NCBI conserved domain tool[36] was used to search against the Pfam v34.0–19,178 PSSMs database for AP2/EREBP, COX and LTP proteins. The InterPro tool[37] was used to analyze the domains of the AP2/EREBP, COX and LTP proteins. MEME 5.5.2[38] was used to compute the conserved motifs of the AP2/EREBP, COX and LTP proteins. Pfam[39] was used for motif description. The gene structures obtained from the GFF file were downloaded from the phytozome of the Z. mays L. genome and subsequently illustrated using TBtools[33].
The promoter sequences of the AP2/EREBP, COX and LTP genes in Z. mays L.1500 bp upstream of the TSS of each AP2/EREBP, COX and LTP gene were retrieved from the Z. mays L. genome sequence file and downloaded from the Phytozome database[27]. Cis-regulatory elements (CREs) were also analyzed in Plant CARE[40]. A graphical representation of the CRE elements present in the promoter region of the gene was generated via TBTool[33].
Subcellular localization, nuclear localization signal, transmembrane helices, phosphorylation...
Subcellular localization predictor (CELLO) version 2.5 (http://cello.life.nctu.edu.tw/)[41] was used to predict the subcellular localization of the proteins, and TBtools was used to visualize the results[33]. NLSDB[42] was used to search for nuclear localization signal potentials. The TMHMM server version 2.0[43] confirmed the presence of transmembrane helical domains (TMs) in the AP2/EREBP, COX and LTP proteins. The NetPhos 3.1 server[44] was used to predict the phosphorylation sites of the AP2/EREBP, COX and LTP proteins. The I-TASSER[45] program predicted the three-dimensional (3-D) structure of the AP2/EREBP, COX and LTP proteins.
Prediction of miRNAs targeting the AP2/EREBP, COX and LTP genes
The psRNATarget database[46] and miRBase[47] were used to predict miRNAs. IPknot[48] was used to predict RNA secondary structures with pseudoknots for the AP2/EREBP, COX and LTP proteins.
Gene Ontology enrichment and functional relationship analysis of the AP2/EREBP, COX and LTP g...
ShinyGO 0.77[49] was used for Gene Ontology enrichment analysis. We performed a gene ontology (GO) annotation analysis by submitting all the AP2/EREBP, COX and LTP gene sequences to the eggNOG database[50] and Phytozome database[27]. The GO annotation data were processed in SRPLOT[51] to construct the gene ontology chord for the functional relationships of the AP2/EREBP, COX and LTP genes.
Maize plant growth and drought treatment
These experiments were conducted in the Department of Botany and Microbiology, Faculty of Science at Cairo University. The seeds used in this study were obtained from the Agricultural Research Center (ARC), located in Giza, Egypt. The seeds originated from Egypt and were certified to be of the white three-way cross 310 variety. Drought treatment was conducted in 2 groups. The first group consisted of control plants, whereas the other consisted of stressed plants. Thirty seeds were planted in small pots in a growth room for 14 days. The second group of stressed plants was subjected to continuous water withholding for 12 h, while the first group was treated with Hoagland's solution as a control. The plants were harvested after 12 h of drought stress. Three control plants and three stressed plants were subjected to RNA extraction and sequencing.
RNA isolation, qRT‒PCR expression analysis and sequencing
This study identified AP2/EREBP (forward primer: AACCCAAGAACACGCTTCCT and reverse primer: AAGCCACATCCCATCCCAAC), COX (forward primer: TCCGTAGTTGGGATTCGTCG and reverse primer: CTGGATTGGTTTCTAGTTTCTTTGA) and LTP genes (forward primer: ATAGGAACGTACGCACGCAG and reverse primer: ATGCAAGTCGTGATCATGCG). Total RNA was isolated from the leaves of 15-day-old Z. mays L. seedlings using a GeneTireX kit. The residual DNA was removed using RNase-free recombinant DNase I (Thermo Scientific, Litwania). First-strand cDNA was synthesized in a 20 μL reaction mixture using a Grisp reverse transcription kit (https://grisp.pt/) with approximately two micrograms of DNA-free total RNA from each sample. qRT‒PCR was performed to quantify the relative transcription levels of the AP2/EREBP, COX and LTP genes expressed in the leaves. qPCR was performed with a CFX Connect Real-Time PCR System (Bio-Rad, Singapore) under the following conditions: 94 °C for 5 min; 40 cycles of 94 °C for 10 s, 58 °C for 20 s, and 72 °C for 30 s; a plate read; a melt curve of 65–95 °C with an increment of 0.5 °C for 10 s; and subsequent sequencing. The Ct (cycle threshold) value was used as a measure of the starting copy number of the target gene[52]. The relative gene expression level was calculated using the 2−ΔΔCT method[53]. Actin (Act) was used as an internal reference gene. The forward primer used was CTGAGGTTCTATTCCAGCCATCC, and the reverse primer used was CCACCACTGAGGACAACATTACC.
Ethical approval
The authors declare that the experimental research work involving the growth of plants in this study, was conducted in compliance with relevant institutional, national, and international guidelines and legislation.
Results
Identification of the AP2/EREBP, COX and LTP genes in Z. mays L.
A total of 78 AP2/EREBP, 6 COX and 10 LTP candidate genes were retrieved from the Z. mays L. genome and were named according to their chromosomal positions from AP2-EREBP-1 to AP2-EREBP-78, COX-1 to COX-6 and LTP-1 to LTP-10 for the AP2/EREBP, COX and LTP genes, respectively (Table S1 Online Resource SI 1).
Characterization of the AP2/EREBP, COX and LTP proteins in Z. mays L.
The sequence identities of 78 AP2/EREBP, 6 COX and 10 LTP proteins are shown by the color-by-E-value ratio (blue, ≤ 60%; green, ≤ 80%; orange, ≤ 90%), as shown in Fig. 1. Analysis of protein physical and chemical properties revealed that the length of the AP2/EREBP family amino acids in Z. mays L. ranged from 154 (AP2-EREBP-28) to 452 (AP2-EREBP-18). The length of the COX family amino acids ranged from 88 (COX-3) to 483 (COX-1). The length of the LTP family amino acids ranged from 106 (LTP-5) to 247 (LTP-1). The molecular weights (MWs) of AP2/EREBP ranged from 16837.95 (AP2-EREBP-28) to 48127.18 (AP2-EREBP-18). The molecular weights of COX ranged from 9972.12 (COX-3) to 51,834.35 (COX-1). The molecular weights of the LTPs ranged from 11062.05 (LTP-5) to 24921.63 (LTP-1). The isoelectric point (PI) of AP2/EREBP ranged from 4.63 (AP2-EREBP-30) to 10.31 (AP2-EREBP-10). The isoelectric point of COX ranged from 4.46 (COX-4) to 10.25 (COX-1). The isoelectric point (p-P) of LTP ranged from 4.69 (LTP-7) to 9.73 (LTP-5). The total number of atoms in AP2/EREBP ranged from 2329 (AP2-EREBP-28) to 6674 (AP2-EREBP-24). The total number of atoms in COX ranged from 1361 (COX-3) to 7348 (COX-1). The total number of atoms in the LTP ranged from 1564 (LTP-5) to 3509 (LTP-1). The average hydropathicity value (GRAVY) of AP2/EREBP ranged from − 0.787 (AP2-EREBP-13) to − 0.408 (AP2-EREBP-58). The average hydropathicity value of COX ranged from − 0.559 (COX-6) to 0.231 (COX-1). The average hydropathicity value of LTP ranged from 0.147 (LTP-10) to 0.683 (LTP-6) (Table S1 Online Resource SI 1).
Graph: Figure 1Sequence identity of the AP2/EREBP, COX and LTP proteins.
Phylogenetic, chromosomal distribution, evolutionary analysis and synteny analysis of the AP2...
A phylogenetic tree was constructed using maximum likelihood with 1000 bootstrap replicates, and the AP2/EREBP, COX and LTP protein sequences were used to analyze the possible evolutionary history of Z. mays L. In the resulting phylogenetic tree, the AP2/EREBP proteins were classified into three distinct clades. The AP2/EREBP protein family (AP2) includes five different domain types according to the Phytozome-13 website[27]: the AP2/ERF domain, EREBP-like factor (EREBP), ethylene responsive factor (ERF), dehydration responsive element binding protein (DREB) and SHN SHINE (Fig. 2 and Table S2 Online Resource SI 1). COX and LTP proteins were classified into three distinct clades (Fig. S1. Online Resource SI 2).
Graph: Figure 2Maximum likelihood phylogenetic tree of the AP2/EREBP protein family in Z. mays L . ; the proteins are labeled with ☆ for the AP2/ERF domain, ○ for the EREBP-like factor (EREBP), □ for the ethylene responsive factor (ERF), ◇ for the dehydration responsive element binding protein (DREB) and ◁ for the SHN SHINE.
Based on the information available on the Phytozome-13 website[27], the AP2/EREBP, COX and LTP genes were physically drawn on the chromosomes in the Z. mays L. genome. AP2/EREBP genes were found on 10 chromosomes of Z. mays L. COX genes were found on chromosomes 1, 3, 4, 5, 7 and 8. LTP genes were found on chromosomes 1, 3, 6, 8, 9 and 10 (Fig. 3).
Graph: Figure 3Distribution of the AP2/EREBP , COX and LTP genes on Z. mays L . chromosomes.
The selective pressure on the AP2/EREBP, COX and LTP genes was investigated by calculating the nonsynonymous/synonymous ratio (Ka/Ks). A Ka/Ks ratio > 1 suggested positive selection, a Ka/Ks ratio = 1 indicated neutral selection, and a Ka/Ks ratio < 1 suggested purifying selection[54]. In the present study, the Ka/Ks ratios of the AP2/EREBP paralogous pairs were less than 1, which indicates that the AP2/EREBP genes were influenced primarily by purifying selection, which suggests that the AP2/EREBP genes received strong environmental pressure during evolution. The Ka/Ks ratios of the COX-3/COX-4 paralogous pairs were greater than 1, which indicated that the COX-3/COX-4 genes were involved in positive or Darwinian selection (driving change). For the LTP genes, the Ka/Ks ratios of the LTP-1/LTP-10, LTP-5/LTP-3 and LTP-4/LTP-8 paralogous pairs were less than 1, while those of the LTP-2/LTP-6 paralogous pairs were greater than 1 (Table 1).
Table 1 Paralogous pairs of AP2/EREBP, COX and LTP genes and the Ka/Ks ratio.
Locus 1 | locus 2 | Ka | Ks | Ka/Ks | Time |
|---|
AP2-EREBP-15 | AP2-EREBP-16 | 0.201887685 | 0.502399279 | 0.401847083 | 38.292628 |
AP2-EREBP-36 | AP2-EREBP-7 | 0.435204658 | 0.87977765 | 0.494675737 | 67.05622333 |
AP2-EREBP-52 | AP2-EREBP-61 | 0.07647816 | 0.207878061 | 0.367899141 | 15.84436439 |
AP2-EREBP-8 | AP2-EREBP-20 | 0.385987339 | 0.570267544 | 0.676853071 | 43.46551404 |
AP2-EREBP-74 | AP2-EREBP-18 | 0.05168891 | 0.193976752 | 0.266469614 | 14.78481342 |
AP2-EREBP-69 | AP2-EREBP-3 | 0.077309887 | 0.187624472 | 0.412045858 | 14.30064575 |
AP2-EREBP-44 | AP2-EREBP-32 | 0.057691935 | 0.122859443 | 0.469576728 | 9.364286818 |
AP2-EREBP-54 | AP2-EREBP-59 | 0.110298946 | 0.164779455 | 0.669373168 | 12.55940971 |
AP2-EREBP-50 | AP2-EREBP-11 | 0.338025374 | 0.624790478 | 0.541021968 | 47.62122548 |
AP2-EREBP-21 | AP2-EREBP-71 | 0.334683458 | 0.545162686 | 0.61391483 | 41.55203397 |
AP2-EREBP-9 | AP2-EREBP-23 | 0.103291176 | 0.277490994 | 0.372232534 | 21.15022823 |
AP2-EREBP-33 | AP2-EREBP-67 | 0.176957458 | 1.324271753 | 0.133626242 | 100.935347 |
AP2-EREBP-47 | AP2-EREBP-63 | 0.128995603 | 0.294776002 | 0.437605512 | 22.46768307 |
AP2-EREBP-4 | AP2-EREBP-30 | 0.449320876 | 0.611974544 | 0.734214978 | 46.64440122 |
AP2-EREBP-49 | AP2-EREBP-64 | 0.056604591 | 0.171835289 | 0.329411909 | 13.09720188 |
AP2-EREBP-37 | AP2-EREBP-73 | 0.290799369 | 0.632410291 | 0.459827067 | 48.2020039 |
AP2-EREBP-34 | AP2-EREBP-35 | 0.187778474 | 0.553114724 | 0.339492814 | 42.15813446 |
AP2-EREBP-42 | AP2-EREBP-26 | 0.083190211 | 0.207698132 | 0.400534227 | 15.83065032 |
COX-3 | COX-4 | 0.100244299 | 0.068451386 | 1.464459755 | 5.217331218 |
LTP-1 | LTP-10 | 0.80611789 | 1.265784761 | 0.636852264 | 96.477497 |
LTP-2 | LTP-6 | 0.837292901 | 0.570546713 | 1.467527341 | 43.48679218 |
LTP-5 | LTP-3 | 0.397424829 | 0.419284855 | 0.947863543 | 31.95768715 |
LTP-4 | LTP-8 | 0.111949387 | 0.25012764 | 0.447569039 | 19.06460671 |
The duplication time of the AP2/EREBP paralogous gene pairs in Z. mays L. ranged from approximately 9.364 to 100.935 Mya. The duplication time of the COX-3/COX-4 paralogous gene pair was approximately 5.217 Mya. The duplication time of the LTP paralogous gene pairs ranged from approximately 19.064 to 96.477 Mya (Fig. 4 and Table 1).
Graph: Figure 4Segmental and tandem duplication of AP2/EREBP , COX and LTP among the Z. mays L . chromosomes.
The AP2/EREBP, COX and LTP genes were analyzed for interspecies collinearity to determine the orthologous relationships of Z. mays L. with O. sativa, H. vulgare and A. thaliana. Collinearity analysis revealed robust orthologs of the AP2/EREBP, COX and LTP genes among Z. mays L. compared with those of the other three plant species (Fig. 5 and Table S3 Online Resource SI 1).
Graph: Figure 5The collinear relationships of the AP2/EREBP , COX and LTP genes are shown as colored lines in the phylogenetic tree.
Conserved domain, conserved motif and gene structure and Promoter analyses of the AP2/EREBP,...
Domain analysis was carried out for all 78 AP2/EREBP, 6 COX and 10 LTP proteins, and domain analysis confirmed the presence of the AP2 domain (Fig. 6), Cyt_c_Oxidase_Vb domain (Fig. S2 Online Resource SI 2) and the nsLTP1 domain (Fig. S3. Online Resource SI 2) on the AP2/EREBP, COX and LTP proteins, respectively. Motif analysis indicated that the phylogenetic relationships were similar to the conserved motif distributions within the clade. For instance, the motif distributions of the AP2/EREBP, COX and LTP proteins exhibited similar motifs within the clade, with few differences. The AP2/EREBP motif distributions for AP2-EREBP-26, AP2-EREBP-42, AP2-EREBP-68, AP2-EREBP-43, AP2-EREBP-27, AP2-EREBP-14, AP2-EREBP-75, AP2-EREBP-41, AP2-EREBP-66, AP2-EREBP-35, AP2-EREBP-34, AP2-EREBP-22, AP2-EREBP-73, AP2-EREBP-37, AP2-EREBP-30, AP2-EREBP-4, AP2-EREBP-46, AP2-EREBP-13, AP2-EREBP-77, AP2-EREBP-64 and AP2-EREBP-49 proteins had conserved motif numbers 1, 2, 3, and 8. The AP2-EREBP-67, AP2-EREBP-33, AP2-EREBP-51, AP2-EREBP-12, AP2-EREBP-78, AP2-EREBP-28, AP2-EREBP-63 and AP2-EREBP-47 proteins carried conserved motif numbers 1, 2, 3, and 9. The remaining AP2/EREBP proteins carried conserved motif numbers 1, 2 and 3 (Fig. 6 and Sheet 2 Online Resource SI 1). The COX motif distributions for the COX-4, COX-3, COX-2 and COX-6 proteins revealed conserved motif numbers 1 and 3 (Fig. 6 and Sheet 3 Online Resource SI 1). Most of the LTP proteins presented conserved motif numbers of 1, 2 and 3 (Fig. 6 and Sheet 4 Online Resource SI 1). The exon‒intron structure is an important source of plant biodiversity and gene family evolution. The gene structure results revealed that 21 of the 78 AP2/EREBP genes had introns (Fig. 6). All the COX genes had introns, while 8 LTP genes had introns (Fig. S2 and Fig. S3 Online Resource SI 2).
Graph: Figure 6AP2/EREBP proteins. (a) Rectangular phylogenetic tree. (b) Conserved motifs were predicted using MEME. (c) Protein domains. (d) Gene structure.
The AP2/EREBP, COX and LTP gene sequences (1500 bp upstream of the start codon) (Table S4 Online Resource SI 1) were selected for cis-element analysis using the PlantCARE web tool to identify their biological functions (stress response, growth and development). The promoter regions of the AP2/EREBP, COX and LTP genes in Z. mays L. contain a large number of plant hormone response elements. Most AP2/EREBP, COX and LTP proteins contain defense and stress response elements, abscisic acid-responsive elements, methyl jasmonate (MeJA)-responsive elements, salylic acid and the MYB binding site (MBS) element, which are involved in the drought response (Fig. 7).
Graph: Figure 7Cis‐acting elements in the promoter regions (1500 bp upstream of the start codon) of the AP2/EREBP , COX and LTP genes .
Subcellular localization, nuclear localization signal, transmembrane helices, phosphorylation...
Subcellular localization analysis revealed that most of the AP2/EREBP proteins were located in the nucleus. COX proteins were predicted to be expressed in different organelles; for instance, COX-1 was predicted to be expressed in the plasma membrane, whereas COX-2 and COX-6 were predicted to be expressed in chloroplasts. Most of the LTP proteins were located in the extracellular space. A heatmap was constructed to predict the subcellular localization of the AP2/EREBP, COX and LTP proteins, as shown in Fig. S4 Online Resource SI 2 and Table S5 Online Resource SI 1.
Sixteen putative nuclear localization signals (NLSs) were predicted for 21 AP2/EREBP proteins, whereas no nuclear localization signals (NLSs) were predicted for COX or LTP proteins (Table S6 Online Resource SI 1).
The TMHMM results predicted the transmembrane helices in AP2-EREBP-10, AP2-EREBP-21, COX-1 and all 10 LTP proteins (Fig. S5, S6 and S7 Online Resource SI 2).
The phosphorylation site prediction results for the AP2/EREBP, COX and LTP proteins for kinases are shown in Table S7 Online Resource SI 1.
To study the putative functions of the AP2/EREBP, COX and LTP proteins in Z. mays L., we selected a protein from each clade. The AP2-EREBP-24, AP2-EREBP-51, AP2-EREBP-53, COX-1, COX-2, COX-5, LTP-1, LTP-3 and LTP-7 proteins were modeled with I-TASSER software to construct 3-D structures. The 3-D structures were constructed according to similar structural templates and crystal structures obtained from the Protein Data Bank (Fig. 8). C-scores were used to estimate the confidence of the constructed protein model for the AP2-EREBP-24, AP2-EREBP-51, AP2-EREBP-53, COX-1, COX-2, COX-5, LTP-1, LTP-3 and LTP-7 proteins. The closest structural similarity protein models were selected as the best-predicted models for the AP2/EREBP, COX and LTP proteins, with C-scores ranging (Table 2). Due to their structural similarity, proteins that are structurally close to the target in the PDB often have similar functions. The C-scores suggested that the structures of the AP2/EREBP, COX and LTP proteins were constructed with high accuracy.
Graph: Figure 8Structural analysis of the AP2-EREBP-24, AP2-EREBP-51, AP2-EREBP-53, COX-1, COX-2, COX-5, LTP-1, LTP-3 and LTP-7 proteins.
Table 2 Modeling parameters for the AP2/EREBP, COX and LTP proteins.
Protein | C-Score | TM-Score | RMSD (Å) | Best Identified Structural Analogs in PDB |
|---|
PDB Hit | TM-Score a | RMSD a | IDEN a | Cov |
|---|
AP2-EREBP-24 | − 1.98 | 0.48 ± 0.15 | 11.8 ± 4.5 | 5fmwA | 0.896 | 2.59 | 0.094 | 0.957 |
AP2-EREBP-51 | − 3.82 | 0.30 ± 0.10 | 14.9 ± 3.6 | 6fokA | 0.438 | 5.86 | 0.053 | 0.748 |
AP2-EREBP-53 | − 2.77 | 0.40 ± 0.13 | 11.8 ± 4.5 | 5wx9A | 0.561 | 2.35 | 0.315 | 0.634 |
COX-1 | − 1.50 | 0.53 ± 0.15 | 10.8 ± 4.6 | 6a2jA | 0.623 | 1.12 | 0.154 | 0.631 |
COX-2 | − 2.04 | 0.47 ± 0.15 | 9.5 ± 4.6 | 6t15d | 0.690 | 1.18 | 0.283 | 0.727 |
COX-5 | − 4.30 | 0.26 ± 0.08 | 16.4 ± 3.0 | 6rc9A1 | 0.435 | 6.24 | 0.063 | 0.771 |
LTP-1 | − 4.31 | 0.26 ± 0.08 | 16.5 ± 3.0 | 5owvC | 0.536 | 4.62 | 0.044 | 0.757 |
LTP-3 | − 1.19 | 0.57 ± 0.15 | 6.8 ± 4.1 | 4xuwA | 0.718 | 0.88 | 0.446 | 0.748 |
LTP-7 | − 0.89 | 0.60 ± 0.14 | 6.1 ± 3.8 | 4xuwA | 0.720 | 1.08 | 0.319 | 0.765 |
Prediction of miRNAs targeting the AP2/EREBP, COX and LTP proteins
A total of 187 microRNAs were predicted to target the AP2/EREBP genes, 48 microRNAs were predicted to target COX proteins, and 30 microRNAs were predicted to target LTP genes. The microRNA targeting relationships for the AP2/EREBP, COX and LTP genes are shown in Table S8 Online Resource SI 1.
The results from the prediction of RNA secondary structures with pseudoknots for the AP2/EREBP (AP2-EREBP-24, AP2-EREBP-51 and AP2-EREBP-53); COX (COX-1, COX-2 and COX-5); and LTP (LTP-1, LTP-3 and LTP-7) proteins are shown in Fig. S8: Fig. S16 Online Resource SI 2.
Gene ontology enrichment and functional relationship analysis
To further determine the functions of the AP2/EREBP, COX and LTP genes, we performed enrichment analysis and gene ontology (GO) analysis based on biological processes and molecular functions. GO terms help us understand the function of genes at the molecular level (Figs. S17, S18 and S19 Online Resource SI 2). GO terms for the AP2/EREBP, COX and LTP genes confirmed the functional role of AP2/EREBP, COX and LTP as stress responsive genes (Fig. S20, S21 and S22 Online Resource SI 2).
In the present study, qRT‒PCR analysis revealed that the AP2/EREBP, COX and LTP proteins were expressed in leaves, and drought decreased the expression levels of AP2/EREBP, COX and LTP by 0.84, 0.53 and 0.31, respectively, after 12 h of drought stress (Sheet 1 Online Resource SI 1). Domain structure, promoter and gene ontology enrichment analyses confirmed the functional role of the AP2/EREBP, COX and LTP proteins in stress responses.
Discussion
Genome-wide analysis identified 78 AP2/EREBP genes in Z. mays L. Phylogenetic classification revealed that the 78 AP2/EREBP proteins could be divided into three distinct clades, which included the AP2/ERF domain, the EREBP-like factor (EREBP), the ethylene responsive factor (ERF), the dehydration responsive element binding protein (DREB) and the SHN SHINE according to the description available on Phytozome-13[27]. Cheng et al.[55] identified 229 AP2/ERF genes in the maize genome. In addition, phylogenetic analysis revealed that the ZmAP2/ERF family members could be divided into five clades, namely, 27 AP2 (APETALA2), 105 ERF (ethylene responsive factor), 89 DREB (dehydration responsive element binding), 5 RAV (related to ABI3/VP) and a soloist. In this study, we identified 6 COXs in Z. mays L. To date, no comprehensive investigation of the COX gene in maize has been reported via genome-wide analysis. We also identified 10 LTP genes in Z. mays L. Wei and Zhong[22] identified 63 LTP genes in maize, which were divided into six types, whereas Fang et al.[56] identified 65 LTP genes in maize. Our qRT‒PCR results indicated that AP2/EREBP COX and LTP were downregulated, with fold changes of 0.84, 0.53 and 0.31, respectively, under drought stress. Sharoni et al.[57] reported the same results for the AP2, DREB, and ERF genes in the IR77298-14-1-2-B-10 line; these genes were highly activated in leaves under severe stress treatment and downregulated under severe stress treatment. Similarly, Trindade et al.[58] reported the same results in Medicago truncatula for COX5b, which strongly downregulated under water deficit conditions. Wei and Zhong[22] reported the same results in maize, in four ZmLTP which were downregulated under drought stress. These results suggest that, under drought stress, ZmLTP genes may exhibit tissue-specific expression because ZmLTP1.2 was significantly downregulated in ovarian tissue but upregulated in the leaf meristem. In the present study, Pfam domain analysis confirmed the presence of the AP2 domain, Cyt_c_Oxidase_Vb and nsLTP1 on the AP2/EREBP, COX and LTP proteins, respectively. Motif and gene structure analyses indicated that genes with closer phylogenetic relationships exhibited more similar genetic structures. The promoter regions of the AP2/EREBP, COX and LTP genes contain defense and stress response elements, abscisic acid-responsive elements, methyl jasmonate (MeJA)-responsive elements, salylic acid and the MYB binding site (MBS) element, which are involved in the drought response. The AP2/EREBP genes were found on 10 chromosomes of Z. mays L., the same results were found by Cheng et al[55]. COX genes were found on chromosomes 1, 3, 4, 5, 7 and 8. LTP genes were found on chromosomes 1, 3, 6, 8, 9 and 10. The Ka/Ks ratios of the AP2/EREBP paralogous pairs were less than 1, which indicates that the AP2/EREBP genes were influenced primarily by purifying selection, which means that the AP2/EREBP genes received strong environmental pressure during evolution. The Ka/Ks ratios of the COX-3/COX-4 paralogous pairs were greater than 1, which indicated that the COX-3/COX-4 genes were involved in positive or Darwinian selection (driving change). For the LTP genes, the Ka/Ks ratios of the LTP-1/LTP-10, LTP-5/LTP-3 and LTP-4/LTP-8 paralogous pairs were less than 1, which indicates that these genes were involved in purifying selection, while the Ka/Ks ratios of the LTP-2/LTP-6 paralogous pairs were greater than 1. Synteny analysis of the AP2/EREBP, COX and LTP proteins revealed collinearity orthologous relationships in O. sativa, H. vulgare and A. thailana. Gene Ontology enrichment analysis confirmed the functional role of stress-responsive AP2/EREBP, COX and LTP.
Conclusion
This is the first study to identify the COX gene in Z. mays L. by genome-wide analysis. Domain structure, promoter and gene ontology enrichment analyses confirmed the functional role of the AP2/EREBP, COX and LTP proteins in stress responses. The results of the present study could improve the understanding of how AP2/EREBP, COX and LTP are mechanistically linked to drought stress responses in maize and could be used for the genetic improvement of maize.
Author contributions
A.M. devised the study, M.A. and A.M. collected the data, conducted the analysis, and discussed the data. A.M. wrote the first draft of the manuscript. Both authors wrote, read, and approved the final version of the manuscript.
Funding
Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).
Data availability
All data generated or analyzed during this study are included in this published article and its supplementary information files.
Competing interests
The authors declare no competing interests.
Supplementary Information
Graph: Supplementary Tables.
Graph: Supplementary Figures.
Abbreviations
-
AP2/EREBP
-
APETALA2/Ethylene-responsive element-binding protein
-
COX
- Cytochrome c oxidase
-
LTP
- Nonspecific lipid transfer protein
- Ka/Ks
- Ratio of nonsynonymous/synonymous
• RMSD
- Root mean square deviation
Supplementary Information
The online version contains supplementary material available at https://doi.org/10.1038/s41598-024-57376-5.
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
[
References
1
Warrick, R. A. Drought Hazard in the United States: A Research Assessment. Monograph no. NSF/RA/E-75/004, 199. (University of Colorado, Institute of Behavorial Science, 1975).
2
Huschke RE. Glossary of Meteorology. 1959; American Meteorological Society: 638
3
Rosenberg, N. J, ed. Drought in the Great Plains-Research on impacts and strategies. In Proceedings of the Workshop on Research in Great Plains Drought Management Strategies, University of Nebraska, Lincoln 225. (Water Resources Publications, 1979).
4
Yevjevich, V, Hall, W. A. & Salas, J. D, eds. Drought research needs. In Proceedings of the Conference on Drought Research Needs 276. (Colorado State University, 1977).
5
The Food and Agriculture Organization (FAO) https://www.fao.org
6
Maazou ARS, Tu J, Qiu J, Liu Z. Breeding for drought tolerance in maize (Zea mays L.). Am. J. Plant Sci. 2016; 7; 14: 1858. 10.4236/ajps.2016.714172
7
Xie Z, Nolan TM, Jiang H, Yin Y. AP2/ERF transcription factor regulatory networks in hormone and abiotic stress responses in arabidopsis. Front. Plant Sci. 2019; 10: 228. 10.3389/fpls.2019.00228. 30873200. 6403161
8
Kizis D, Lumbreras V, Pagès M. Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Lett. 2001; 498; 2–3: 187-189. 1:CAS:528:DC%2BD3MXksVGlu7g%3D. 10.1016/s0014-5793(01)02460-7. 11412854
9
Chen L, Han J, Deng X, Tan S, Li L, Li L, Zhou J, Peng H, Yang G, He G, Zhang W. Expansion and stress responses of AP2/EREBP superfamily in Brachypodium distachyon. Sci. Rep. 2016; 6: 21623. 2016NatSR.621623C. 1:CAS:528:DC%2BC28XisFSks70%3D. 10.1038/srep21623. 26869021. 4751504
Pande A, Saxena S, Thapliyal M, Guru S, Kumar A, Arora S. Role of AP2/EREBP transcription factor family in environmental stress tolerance. Cell Cell. Life Sci. J. 2018. 10.23880/CCLSJ-16000120
Liu C, Zhang T. Expansion and stress responses of the AP2/EREBP superfamily in cotton. BMC Genom. 2017; 18: 118. 1:CAS:528:DC%2BC1cXjt1Cjtb8%3D. 10.1186/s12864-017-3517-9
Dietz KJ, Vogel MO, Viehhauser A. AP2/EREBP transcription factors are part of gene regulatory networks and integrate metabolic, hormonal and environmental signals in stress acclimation and retrograde signaling. Protoplasma. 2010; 245; 1–4: 3-14. 1:CAS:528:DC%2BC3cXhtVymu7bE. 10.1007/s00709-010-0142-8. 20411284
Li B, Li Q, Mao X, Li A, Wang J, Chang X, Hao C, Zhang X, Jing R. Two novel AP2/EREBP transcription factor genes TaPARG have pleiotropic functions on plant architecture and yield-related traits in common wheat. Front. Plant Sci. 2016; 7: 1191. 10.3389/fpls.2016.01191. 27555860. 4977303
Zhou Y, Xia H, Li X-J, Hu R, Chen Y. Overexpression of a cotton gene that encodes a putative transcription factor of AP2/EREBP family in Arabidopsis affects growth and development of transgenic plants. PLoS ONE. 2013; 8; 10: e78635. 2013PLoSO.878635Z. 1:CAS:528:DC%2BC3sXhslSjs7rK. 10.1371/journal.pone.0078635. 24194949. 3806861
Jett KA, Leary SC. Building the CuA site of cytochrome c oxidase: A complicated, redox-dependent process driven by a surprisingly large complement of accessory proteins. J. Biol. Chem. 2017; 293: 4644-4652. 10.1074/jbc.R117.816132. 28972150. 5880131
Mansilla N, Racca S, Gras DE, Gonzalez DH, Welchen E. The complexity of mitochondrial complex IV: An update of Cytochrome c Oxidase biogenesis in plants. Int. J. Mol. Sci. 2018; 19: 662. 10.3390/ijms19030662. 29495437. 5877523
Ikeda TM, Tsunewaki K. Deficiency of cox1 gene expression in wheat plants with Aegilops columnaris cytoplasm. Curr. Genet. 1996; 6: 509-514. 10.1007/s002940050163
D'Agostino N, Buonanno M, Ayoub J. Identification of non-specific Lipid Transfer Protein gene family members in Solanum lycopersicum and insights into the features of Sola l 3 protein. Sci. Rep. 2019; 9: 1607. 2019NatSR.9.1607D. 1:CAS:528:DC%2BC1MXns1OktLg%3D. 10.1038/s41598-018-38301-z. 30733555. 6367377
Mikołajczak K, Ogrodowicz P, Surma M, Adamski T, Kuczyńska A. Introgression of LTP2 gene through marker assisted backcross in barley (Hordeum vulgare L.). Electron. J. Biotechnol. 2016; 24: 9-11. 10.1016/j.ejbt.2016.09.003
Guo L, Yang H, Zhang X, Yang S. Lipid transfer protein 3 as a target of MYB96 mediates freezing and drought stress in Arabidopsis. J. Exp. Bot. 2013; 64: 1755-1767. 1:CAS:528:DC%2BC3sXlsV2ktbw%3D. 10.1093/jxb/ert040. 23404903. 3617838
Salminen TA, Blomqvist K, Edqvist J. Lipid transfer proteins: Classification, nomenclature, structure, and function. Planta. 2016; 244: 971-997. 1:CAS:528:DC%2BC28XhsVWjsbnL. 10.1007/s00425-016-2585-4. 27562524. 5052319
Wei K, Zhong X. Non-specific lipid transfer proteins in maize. BMC Plant Biol. 2014; 14: 281. 10.1186/s12870-014-0281-8. 25348423. 4226865
Guo C, Ge X, Ma H. The rice OsDIL gene plays a role in drought tolerance at vegetative and reproductive stages. Plant Mol. Biol. 2013; 82: 239-253. 1:CAS:528:DC%2BC3sXosFKqs78%3D. 10.1007/s11103-013-0057-9. 23686450
Yu G, Hou W, Du X, Wang L, Wu H, Zhao L, Kong L, Wang H. Identification of wheat non-specific lipid transfer proteins involved in chilling tolerance. Plant Cell Rep. 2014; 33: 1757-1766. 1:CAS:528:DC%2BC2cXhtFyjtbrF. 10.1007/s00299-014-1655-y. 25037996
Tapia G, Morales-Quintana L, Parra C, Berbel A, Alcorta M. Study of nsLTPs in Lotus japonicus genome reveal a specific epidermal cell member (LjLTP10) regulated by drought stress in aerial organs with a putative role in cutin formation. Plant Mol. Biol. 2013; 82: 485-501. 1:CAS:528:DC%2BC3sXpsFKltro%3D. 10.1007/s11103-013-0080-x. 23733601
Edstam MM, Laurila M, Höglund A, Raman A, Dahlström KM, Salminen TA, Edqvist J, Blomqvist K. Characterization of the GPI-anchored lipid transfer proteins in the moss Physcomitrella patens. Plant Physiol. Biochem. 2014; 75: 55-69. 1:CAS:528:DC%2BC2cXhsVyhu74%3D. 10.1016/j.plaphy.2013.12.001. 24374350
Goodstein DM, Shu SH, Howson R, Neupane R, Hayes RD, Fazo J, Mitros TH, Dirks W, Hellsten U, Putnam N, Rokhsar DS. Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res. 2012; 40: D1178-D1186. 1:CAS:528:DC%2BC3MXhs12htbjE. 10.1093/nar/gkr944. 22110026
Resource Coordinators NCBI, Agarwala R, Barrett T, Beck J, Benson DA, Bollin C, Bolton E, Bourexis D, Brister JR, Bryant SH. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2018; 46: D8-D13. 10.1093/nar/gkx1095
Darzentas N. Circoletto: Visualizing sequence similarity with Circos. Bioinformatics. 2010; 26; 20: 2620-2621. 1:CAS:528:DC%2BC3cXht1Ogs7vO. 10.1093/bioinformatics/btq484. 20736339
Gasteiger, E, et al.Protein Identification and Analysis Tools on the ExPASy Server 571–607 (2005)
Tamura K, Stecher G, Kumar S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021; 38: 3022-3027. 1:CAS:528:DC%2BB3MXitlCktrfN. 10.1093/molbev/msab120. 33892491. 8233496
Letunic I, Bork P. Interactive tree of life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019; 47: W256-W259. 1:CAS:528:DC%2BB3cXktVyiur4%3D. 10.1093/nar/gkz239. 30931475. 6602468
Chen C. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant. 2020; 13: 1194-1202. 1:CAS:528:DC%2BB3cXhsVCltLzE. 10.1016/j.molp.2020.06.009. 32585190
Yang S, Zhang X, Yue J-X, Tian D, Chen J-Q. Recent duplications dominate NBS-encoding gene expansion in two woody species. Mol. Genet. Genom. 2008; 280: 187-198. 1:CAS:528:DC%2BD1cXhtFCqsbjF. 10.1007/s00438-008-0355-0
Gu Z, Cavalcanti A, Chen FC, Bouman P, Li WH. Extent of gene duplication in the genomes of Drosophila, nematode, and yeast. Mol. Biol. Evol. 2002; 19; 3: 256-262. 1:CAS:528:DC%2BD38XitFSnsL4%3D. 10.1093/oxfordjournals.molbev.a004079. 11861885
Lu S, Wang J. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020; 48; D1: D265-D268. 1:CAS:528:DC%2BB3cXhs1GltrjM. 10.1093/nar/gkz991. 31777944
Paysan-Lafosse T. InterPro in 2022. Nucleic Acids Res. 2022. 10.1093/nar/gkac993. 9825450
Bailey TL, Johnson J, Grant ChE, Noble WS. The MEME suite. Nucleic Acids Res. 2015; 43; W1: W39-W49. 1:CAS:528:DC%2BC2sXhtVymtbrO. 10.1093/nar/gkv416. 25953851. 4489269
Mistry J. The protein families database in 2021. Nucleic Acids Res. 2020. 10.1093/nar/gkaa913. 31647099. 7779014
Rombauts S, Déhais P, Van Montagu M, Rouzé P. PlantCARE, a plant cis-acting regulatory element database. Nucleic Acids Res. 1999; 27: 295-296. 1:CAS:528:DyaK1MXpsVKgtQ%3D%3D. 10.1093/nar/27.1.295. 9847207. 148162
Yu CS, Chen YC, Lu CH, Hwang JK. Prediction of protein subcellular localization. Proteins Struct. Funct. Bioinform. 2006; 64: 643-651. 1:CAS:528:DC%2BD28Xnt1OgtLo%3D. 10.1002/prot.21018
Nair R, Carter P, Rost B. NLSdb: Database of nuclear localization signals. Nucleic Acids Res. 2003; 31; 1: 397-399. 1:CAS:528:DC%2BD3sXhvFSmurs%3D. 10.1093/nar/gkg001. 12520032. 165448
Krogh A, Larsson B, Von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001; 305: 567-580. 1:CAS:528:DC%2BD3MXisFCguw%3D%3D. 10.1006/jmbi.2000.4315. 11152613
Blom N, Gammeltoft S, Brunak S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 1999; 294; 5: 1351-1362. 1:CAS:528:DyaK1MXnvFaqsrg%3D. 10.1006/jmbi.1999.3310. 10600390
Zheng W, Zhang Ch, Li Y, Pearce R, Bell EW, Zhang Y. Folding non-homologous proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Rep. Methods. 2021; 1: 100014. 1:CAS:528:DC%2BB38XitVWgsrbK. 10.1016/j.crmeth.2021.100014. 34355210. 8336924
Dai X, Zhuang Z, Zhao PX. psRNATarget: A plant small RNA target analysis server (2017 release). Nucl. Acids Res. 2018; 46; W1: W49-W54. 1:CAS:528:DC%2BC1MXosVyqt70%3D. 10.1093/nar/gky316. 29718424. 6030838
Kozomara A, Griffiths-Jones S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014; 42: D68-73. 1:CAS:528:DC%2BC2cXos1Wk. 10.1093/nar/gkt1181. 24275495
Sato K, Kato Y. Prediction of RNA secondary structure including pseudoknots for long sequences. Brief. Bioinform. 2022; 23; 1: bbab395. 1:CAS:528:DC%2BB38XjvFantrs%3D. 10.1093/bib/bbab395. 34601552
Ge SX, Jung D, Yao R. ShinyGO: A graphical gene-set enrichment tool for animals and plants. Bioinformatics. 2020; 36: 2628-2629. 1:CAS:528:DC%2BB3cXitlOlsrnP. 10.1093/bioinformatics/btz931. 31882993
Cantalapiedra CP, Hernandez-Plaza A, Letunic I, Bork P, Huerta-Cepas J. eggNOG-mapper v2: Functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021; 38; 12: 5825-5829. 1:CAS:528:DC%2BB38Xhslyrt78%3D. 10.1093/molbev/msab293. 34597405. 8662613
Tang D, Chen M, Huang X, Zhang G, Zeng L, Zhang G, Wu S, Wang Y. SRplot: A free online platform for data visualization and graphing. PLoS One. 2023; 18; 11: e0294236. 1:CAS:528:DC%2BB3sXitl2iu7zL. 10.1371/journal.pone.0294236. 37943830. 10635526
Chen Y, Hu BY, Tan ZQ, Liu J, Yang ZM, Li ZH, Huang B. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015; 34: 1825-1834. 1:CAS:528:DC%2BC2MXhtFylu7fP. 10.1007/s00299-015-1830-9. 26179072
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001; 25: 402-408. 1:CAS:528:DC%2BD38XhtFelt7s%3D. 10.1006/meth.2001.1262. 11846609
Anton N, Makova KD, Li WH. The Ka/Ks ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 2002; 12: 198-202. 10.1101/gr.200901
Cheng C, An L, Li F, Ahmad W, Aslam M, Ul Haq MZ, Yan Y, Ahmad RM. Wide-range portrayal of AP2/ERF Transcription factor family in maize (Zea mays L.) development and stress responses. Genes (Basel). 2023; 14; 1: 194. 1:CAS:528:DC%2BB3sXhvFylsL4%3D. 10.3390/genes14010194. 36672935
Fang C, Wu S, Li Z, Pan S, Wu Y, An X, Long Y, Wei X, Wan XA. Systematic investigation of lipid transfer proteins involved in male fertility and other biological processes in maize. Int. J. Mol. Sci. 2023; 24; 2: 1660. 1:CAS:528:DC%2BB3sXit1ans7s%3D. 10.3390/ijms24021660. 36675174. 9864150
Sharoni AM, Nuruzzaman M, Satoh K, Moumeni A, Attia K, Venuprasad R, Serraj R, Kumar A, Leung H, Islam AK, Kikuchi S. Comparative transcriptome analysis of AP2/EREBP gene family under normal and hormone treatments, and under two drought stresses in NILs setup by Aday selection and IR64. Mol. Genet. Genom. 2012; 287; 1: 1-19. 1:CAS:528:DC%2BC38Xmtl2i. 10.1007/s00438-011-0659-3
Trindade I, Capitao C, Dalmay T, Fevereiro MP, Santos DM. miR398 and miR408 are upregulatedin response to water deficit in Medicago truncatula. Planta. 2010; 3: 705-771. 10.1007/s00425-009-1078-0
]
By Amaal Maghraby and Mohamed Alzalaty
Reported by Author; Author
