| Sonstiges: |
- Nachgewiesen in: USPTO Patent Applications
- Sprachen: English
- Document Number: 20240084314
- Publication Date: March 14, 2024
- Appl. No: 18/269046
- Application Filed: May 24, 2022
- Claim: 1. A polynucleotide having promoter activity, wherein the polynucleotide is selected from the group shown in any one of the following (i)-(iv): (i) a mutant of a polynucleotide comprising the sequence as set forth in SEQ ID NO: 1, comprising a mutated nucleotide at one or more positions in position 105 to position 126 of the sequence as set forth in SEQ ID NO: 1; (ii) a polynucleotide comprising a sequence complementary to the nucleotide sequence as set forth in (i); (iii) a polynucleotide comprising a reversely complementary sequence of a sequence capable of hybridizing with the nucleotide sequence as set forth in (i) or (ii) under high stringent hybridization conditions or very high stringent hybridization conditions; (iv) a polynucleotide having at least 90%, sequence identity compared with the nucleotide sequence as set forth in (i) or (ii); wherein the polynucleotide as set forth in any one of (i) to (iv) has a nucleotide sequence that is not TTCTCTTTTAAGCGGGATAGCA at position 105 to position 126 of the sequence as set forth in SEQ ID NO: 1; and the polynucleotide as set forth in any one of (i) to (iv) has enhanced promoter activity compared with the polynucleotide having the sequence as set forth in SEQ ID NO: 1.
- Claim: 2. The polynucleotide having promoter activity according to claim 1, wherein the mutant has 0.4 to 13 folds or more improved promoter activity as compared with the promoter activity of the polynucleotide having the sequence as set forth in SEQ ID NO: 1.
- Claim: 3. The polynucleotide having promoter activity according to claim 1, wherein the nucleotide sequence of the mutant corresponding to position 105 to position 126 of the sequence as set forth in SEQ ID NO: 1 is selected from any one of the group consisting of the following (Pmdh-1) to (Pmdh-49): [table included]
- Claim: 4. The polynucleotide having promoter activity according to claim 1, wherein the nucleotide sequence of the mutant is selected from sequences as set forth in any one of SEQ ID NOs: 3 to 51.
- Claim: 5. A transcription expression cassette, comprising the polynucleotide having promoter activity according to claim 1; optionally, wherein the transcription expression cassette further contains a target gene that is operably ligated to the polynucleotide having promoter activity; the target gene is a protein coding gene.
- Claim: 6. A recombinant expression vector comprising the polynucleotide having promoter activity according to claim 1.
- Claim: 7. A recombinant host cell comprising the transcription expression cassette according to claim 5.
- Claim: 8. The recombinant host cell according to claim 7, wherein the host cell is from genus Corynebacterium, genus Brevibacterium, genus Arthrobacterium, genus Microbacterium or genus Escherichia.
- Claim: 9-11. (canceled)
- Claim: 12. A construction method of a promoter mutant, including the following steps: mutation step: mutating a polynucleotide having the sequence as set forth in SEQ ID NO: 1 so that there are mutated nucleotides at one or more positions in position 105 to position 126 of the sequence as set forth in SEQ ID NO: 1; screening step: screening for a mutant of a polynucleotide having improved promoter activity as compared with the polynucleotide having the sequence as set forth in SEQ ID NO: 1, to obtain a promoter mutant.
- Claim: 13. The construction method according to claim 12, wherein the mutation step includes: mutating the polynucleotide having the sequence as set forth in SEQ ID NO: 1 so that the nucleotides at position 105 to position 126 of the sequence as set forth in SEQ ID NO: 1 are mutated to a nucleotide sequence as set forth below: NNNNNNNNNNNNNNNNNTANNNT; wherein N is selected from A, T, C or G; wherein the promoter mutant has 0.4 to 13 folds or more improved promoter activity as compared with the promoter activity of the polynucleotide having the sequence as set forth in SEQ ID NO: 1.
- Claim: 14. A method for regulating transcription, wherein the method includes a step of operably ligating the polynucleotide having promoter activity according to claim 1 to a target RNA or a target gene; wherein the target RNA includes at least one of tRNA, sRNA, the target gene includes at least one of a coding gene of a protein related to the synthesis of a target compound, a coding gene of a gene expression regulatory protein and a coding gene of a protein related to membrane transport.
- Claim: 15. A method for preparing a protein, wherein the method includes a step of expressing the protein by using the transcription expression cassette according to claim 5, in which the protein is a protein related to the synthesis of a target compound, or a gene expression regulatory protein; and the method further includes a step of isolating or purifying the protein.
- Claim: 16. A method for producing a target compound, wherein the method includes a step of expressing a protein related to the synthesis of a target compound, a protein related to membrane transport, or a gene expression regulatory protein by using the transcription expression cassette according to claim 5, and producing the target compound in the presence of the protein associated with the synthesis of the target compound, a protein related to membrane transport, or the gene expression regulatory protein; and the method further includes a step of isolating or purifying the target compound.
- Claim: 17. The recombinant host cell according to claim 8, wherein the host cell is Corynebacterium glutamicum or Escherichia coli.
- Claim: 18. The recombinant host cell according to claim 17, wherein the host cell is Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 14067 or derivative strains of Corynebacterium glutamicum.
- Claim: 19. The method according to claim 14, wherein the target gene includes at least one of the following genes: pyruvate carboxylase gene, phosphoenolpyruvate carboxylase gene, γ-glutamyl kinase gene, glutamate semialdehyde dehydrogenase gene, pyrroline-5-carboxylate eductase gene, amino acid transport protein gene, ptsG system related gene, pyruvate dehydrogenase gene, homoserine dehydrogenase gene, oxaloacetic acid decarboxylase gene, gluconic acid repressor gene, glucose dehydrogenase gene, aspartate kinase gene, aspartate semialdehyde dehydrogenase gene, aspartate ammonia lyase gene, dihydrodipicolinate synthase gene, dihydropyridinic acid reductase gene, succinyl diaminopimelate aminotransferase gene, tetrahydrodipicolinate succinylase gene, succinyl diaminopimelate deacylase gene, diaminopimelic acid epimerase gene, diaminopimelic acid deacylase gene, glyceraldehyde-3-phosphate dehydrogenase gene, transketolase gene, diaminopimelate dehydrogenase gene.
- Claim: 20. The method according to claim 16, wherein the target compound includes at least one of amino acids and organic acids; the amino acids include one or a combination of two or more of the following: lysine, glutamic acid, threonine, proline, hydroxyproline, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, arginine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid or derivatives of any one of the above amino acids; the organic acids include one or a combination of two or more of the following: citric acid, succinic acid, lactic acid, acetic acid, butyric acid, palmitic acid, oxalic acid, oxaloacetic acid, tartaric acid, propionic acid, hexenoic acid, decanoic acid, caprylic acid, valeric acid, malic acid or derivatives of any one of the above organic acids.
- Claim: 21. The method according to claim 16, wherein the protein related to the synthesis of the target compound is a protein related to the synthesis of an L-amino acid; the protein related to the synthesis of an L-amino acid includes one or a combination of two or more of: pyruvate carboxylase, phosphoenolpyruvate carboxylase, γ-glutamyl kinase, glutamate semialdehyde dehydrogenase, pyrroline-5-carboxylate reductase, amino acid transport protein, ptsG system, pyruvate dehydrogenase, homoserine dehydrogenase, oxaloacetic acid decarboxylase, gluconic acid repressor, glucose dehydrogenase, aspartate kinase, aspartate semialdehyde dehydrogenase, aspartate ammonia lyase, dihydrodipicolinate synthase, dihydropyridinic acid reductase, succinyl diaminopimelate aminotransferase, tetrahydrodipicolinate succinylase, succinyl diaminopimelate deacylase, diaminopimelic acid epimerase, diaminopimelic acid deacylase, glyceraldehyde-3-phosphate dehydrogenase, transketolase, diaminopimelate dehydrogenase.
- Current International Class: 12; 12; 12; 12
|
