Polyamine stimulation perturbs intracellular Ca<superscript>2+</superscript> homeostasis and decreases viability of breast cancer BT474 cells.

Intracellular polyamines such as spermine and spermidine are essential to cell growth in normal and especially in cancer cells. However, whether extracellular polyamines affect cancer cell survival is unknown. We therefore examined the actions of extracellular polyamines on breast cancer BT474 cells. Our data showed that spermine, spermidine, and putrescine decreased cell viability by apoptosis. These polyamines also elicited Ca²⁺ signals, but the latter were unlikely triggered via Ca²⁺-sensing receptor (CaSR) as BT474 cells have been demonstrated previously to lack CaSR expression. Spermine-elicited Ca²⁺ response composed of both Ca²⁺ release and Ca²⁺ influx. Spermine caused a complete discharge of the cyclopiazonic acid (CPA)-sensitive Ca²⁺ pool and, expectedly, endoplasmic reticulum (ER) stress. The Ca²⁺ influx pore opened by spermine was Mn²⁺-impermeable, distinct from the CPA-triggered store-operated Ca²⁺ channel, which was Mn²⁺-permeable. Spermine cytotoxic effects were not due to oxidative stress, as spermine did not trigger reactive oxygen species formation. Our results therefore suggest that spermine acted on a putative polyamine receptor in BT474 cells, causing cytotoxicity by Ca²⁺ overload, Ca²⁺ store depletion, and ER stress.

Keywords: breast cancer; Ca2+; cytotoxicity; putrescine; spermidine; spermine

1 Introduction

The functions of intracellular polyamines, concentrations of which reach millimolar levels, include acting as substrates for transglutaminase reactions and synthesis of hypusine, an important translational regulator; polyamines also scavenge free radicals, hence protecting DNA [[1]]. Polyamines have also been implicated in cell growth and cell migration [[1]]. Most importantly, polyamines have been implicated in cell proliferation of cancer cells. Mammalian ornithine decarboxylase is a pyridoxylphosphate-requiring enzyme catalyzing the decarboxylation of the urea cycle amino acid ornithine to the diamine putrescine. S-Adenosylmethionine decarboxylase provides the aminopropyl donor to synthesize higher polyamines, spermidine, and spermine by removing the AdoMet carboxyl group [[2]]. Researchers have probed into the possibility of targeting ornithine decarboxylase for anticancer purposes. Up to date, the most prominent widely deployed inhibitor of polyamine biosynthesis is 2-difluoromethylornithine.

The role of extracellular polyamines, their interaction with a putative plasma membrane receptor, and the consequent biological functions are still elusive. Polyamines, by binding to a putative receptor, stimulate histamine release in mast cells, and this is inhibited by benzalkonium chloride [[3]]. Extracellular polyamines have been known to be agonists of Ca2+-sensing receptors (CaSR), other agonists being Ca2+ and La3+ [[4]]. Biochemical and electrophysiological studies have suggested the existence of a recognition site for polyamines as part of the N-methyl- d -aspartate (NMDA) receptor complex. Polyamines do not directly activate NMDA receptors but could either enhance or suppress glutamate-mediated responses (for a review see [[5]]). This site has been described as a site distinct from the sites for glutamate, glycine, Mg2+, Zn2+, and MK-801 (open channel blocker of NMDA receptor). Polyamines such as spermine and spermidine not only modulate glutamine-elicited currents but also enhance the binding affinity of the open-channel blockers. Because of this, polyamines have been found to modulate learning and memory [[6]].

The role of extracellular polyamines in cell growth and cancer is less understood. Polyamines have been shown to activate caspases and apoptosis in leukemia cells [[7]]. Polyamines have also been shown to cause apoptosis via increasing intracellular transglutaminase activity in bovine aortic endothelial cells and rat aortic smooth muscle cells [[8]]. In this work, we explored how extracellular polyamine could affect breast cancer cells. We found that extracellular spermine profoundly perturbed Ca2+ homeostasis and decreased viability in BT474 breast cancer cells, and we have investigated the mechanisms.

2 Methods

2.1 Materials

Dulbecco's modified Eagle medium (DMEM), fetal calf serum, and tissue culture reagents were purchased from Invitrogen Corporation (Carlsbad, CA, USA). Spermine, spermidine, putrescine, cyclopiazonic acid (CPA), and digitonin were from Sigma-Aldrich (St. Louis, MO, USA). Fura-2 AM was purchased from Calbiochem Millipore (Darmstadt, Germany). Xestospongin C and JVT 519 fumarate were from Tocris Bioscience (Bristol, UK).

2.2 Cell culture

BT474 cells were cultured at 37 °C in 5% CO2 in DMEM supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) and penicillin-streptomycin (100/100 μg/mL) (Invitrogen).

2.3 Assay of cell viability and apoptosis

Cell viability was examined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenltetrazolium bromide (MTT) method. Cells were cultured in a 96-well plate at a density of 1.5×104/well and were then treated with various polyamines for 48 h. MTT (final concentration at 0.5 mg/mL) was subsequently added to each well and then further incubated for 4 h. The culture medium was then removed, and 100 μL of DMSO was added to each well for 15 min (with shaking) to dissolve the precipitates. The absorbance at 595 nm was measured using an enzyme-linked immunosorbent assay reader and was used as an indicator of cell viability or metabolic activity. Thus, a decrease in MTT reduction implies cell death, decrease in cell proliferation, or loss of metabolic activity.

Apoptosis was assessed by the TUNEL method using a kit from Roche (Basel, Switzerland) (cat.# 11684795910), according to the manufacturer's instructions. The cells were examined under a fluorescence microscope (Olympus DP70, Tokyo, Japan).

Caspase 3/7 activities were also measured. Cells were cultured in a 96-well black plate at a density of 1.5×104/well overnight and were then treated with various polyamines for 1 h. Culture medium was removed from each well, and 100 μL of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific, Waltham, MA, USA) was added to each well at a final concentration of 2 μM. The cells were then incubated at 37 °C for 30 min. Fluorescence was detected using a SpectraMax ID3 plate reader (Molecular Devices, San Jose, CA, USA) with excitation at 502 nm and emission at 530 nm.

2.4 Microfluorimetric measurement of cytosolic Ca 2+

Microfluorimetric measurement of cytosolic Ca2+ concentration was performed using fura-2 as the Ca2+-sensitive fluorescent dye as described previously [[9]]. Briefly, cells were incubated with 5 μM fura-2 AM (Invitrogen, Carlsbad, CA, USA) for 1 h at 37 °C and then washed in extracellular bath solution that contained the following (mM): 140 NaCl, 4 KCl, 1 MgCl2, 2 CaCl2, 10 HEPES (pH 7.4 adjusted with NaOH). When intracellular Ca2+ release was assayed, Ca2+-free solution was used. This Ca2+-free solution was the same as the extracellular bath solution mentioned previously except that Ca2+ was omitted and 100 μM ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid was supplemented. Cells were alternately excited with 340 and 380 nm (switching frequency at 1 Hz) using an optical filter changer (Lambda 10-2, Sutter Instruments, Novato, CA, USA). Emission was collected at 500 nm, and images were captured using a charge-coupled device camera (CoolSnap HQ2, Photometrics, Tucson, AZ, USA) linked to an inverted Nikon TE2000-U microscope (Tokyo, Japan). For detection of Mn2+ influx, excitation wavelength was set at 360 nm (isosbestic point at which fura-2 is insensitive to Ca2+), and emission was collected at 500 nm. Images were analyzed with a MAG Biosystems Software (Sante Fe, MN, USA). All imaging experiments were performed at room temperature (25 °C). We measured and analyzed the 340/380 nm ratio changes at a region of interest of single cells within the microscopic views (regarded as one experiment) and then repeated the experiment at least twice to get the mean of all single cells examined.

2.5 Reactive oxygen species (ROS) assay

Cells were incubated in serum-free DMEM containing 20 μM 2,7-dichlorodihydrofluorescein diacetate (DCFH2-DA, Sigma, St. Louis, MO, USA) for 30 min at 37 °C in the dark. After washing, cells were subsequently treated with different agents for various time periods. Cells were then washed, trypsinized for 3 min at 37 °C, and then washed again three more times in phosphate-buffered saline by centrifugation. Cells were dispersed in phosphate-buffered saline, put in polystyrene tubings for fluorescence-activated cell sorting, and then analyzed using a FACS Canto flow cytometer system (BD Biosciences, San Jose, CA, USA). Data were analyzed by BD FACSDIVA™ software (BD Biosciences).

2.6 Western blot

Western blotting was performed as described previously [[10]]. Briefly, cells were washed in cold PBS, lysed for 30 min on ice with radioimmunoprecipitation assay (RIPA) buffer. Protein samples containing 30 μg protein were separated on 10% sodium dodecyl sulfate-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were incubated for 1 h with 5% nonfat milk in PBS buffer to block nonspecific binding. The membranes were incubated with various primary antibodies: anti-actin (1:1000; GeneTex), anti-CHOP, anti-eIF2-α, and anti-p-eIF2-α (all 1:1000; Cell Signaling, Danvers, MA, USA). Subsequently, the membranes were incubated with goat anti-rabbit or goat anti-mouse peroxidase-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA) for 1 h. The blots were visualized by enhanced chemiluminescence (ECL; Millipore, Darmstadt, Germany) using Kodak X-OMAT LS film (Eastman Kodak, Rochester, NY, USA).

2.7 RNA isolation and quantification of CHOP mRNA expression

RNA was extracted using an RNA Isolator Total RNA Extraction Reagent (Vazyme, Nanjing, China) and then reverse-transcribed using HiScript II Q RT SuperMix for quantitative polymerase chain reaction (qPCR; +g DNA wiper; Vazyme, Nanjing, China) at 50 °C for 15 min, 85 °C for 5 s, according to the manufacturer's instructions. Total RNA (1000 ng) was reverse transcribed, and the resulting cDNA was amplified using the specific 20× gene expression assays for SYBR Green of DDIT3 (gene for CHOP) and GAPDH (Topgen Biotech., Kaohsiung, Taiwan). qPCR was performed with ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) in a 10 μL reaction on the StepOne Plus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) in accordance to the manufacturer's instructions. Samples (10 ng cDNA) were amplified in triplicates with appropriate nontemplate controls. Amplification data were normalized to the GAPDH expression. Quantification of relative expression (arbitrary units) was performed using the 2−∆∆Ct relative quantification method. Quantitative PCR data showed a variability coefficient of Ct always lower than 2% of mean values.

Primers are as follows:

• 1. GAPDH-Forward GCACCACCAACTGCTTAGCA
• 2. GAPDH-Reverse TCTTCTGGGTGGCAGTGATG
• 3. DDIT3-Forward TGCAAGAGGTCCTGTCTTCAGA
• 4. DDIT3-Reverse TCAGTCAGCCAAGCCAGAGA

2.8 Statistical analysis

Data are presented as means±SEM. The unpaired or paired Student's t-test was used where appropriate to compare two groups. For comparison among multiple groups, one-way analysis of variance with Tukey's honest significant difference post hoc test was used to determine statistical significance. A value of p<0.05 is considered to be significantly different.

3 Results

As shown in Figure 1A, incubation of BT474 cells with different concentrations of spermine for 48 h resulted in a concentration-dependent cell death. We also examined the effects of two other polyamines, spermidine and putrescine, at 48 h. The potency of cytotoxicity of spermidine was comparable to that of spermine (Figure 1B), while putrescine appeared to be less potent, as 10 mM putrescine was required to inflict significant cytotoxicity (Figure 1C). To examine whether polyamines caused apoptotic death, we performed the TUNEL test (Figure 2). All the polyamines at 10 mM caused apoptosis. We further examined whether the polyamines caused apoptosis by increasing caspase activities. Results in Figure 3 indicate that all the polyamines increased the activities of caspase-3/7, suggesting apoptosis occurred via a caspase-3/7-dependent mechanism.

Graph: Figure 1: Polyamines induced cytotoxicity. BT474 cells were treated with different concentrations of spermine (A), spermidine (B), and putrescine (C) for 48 h, and MTT assay was performed to determine cell viability. Results are mean±SEM from four separate experiments. *Significantly (p<0.05) different from control.

Graph: Figure 2: Polyamines induced apoptosis. BT474 cells were treated with 10 mM each of spermine, spermidine, and putrescine for 3 h, and then apoptosis assay was performed. Results are mean±SEM from three separate experiments. *Significantly (p<0.05) different from control.

Graph: Figure 3: Polyamines increased caspase-3/7 activities. BT474 cells were treated with 10 mM each of spermine, spermidine, and putrescine for 1 h, and then caspase-3/7 activities were assayed. Results are mean±SEM from four separate experiments. *Significantly (p<0.05) different from control.

We then examined if these polyamines elicited Ca2+ signals (Figure 4). Spermine and spermidine at ≧3 mM raised [Ca2+]i, while putrescine appeared to be slightly less potent: effect required ≧6 mM. Polyamines are agonists of the Ca2+-sensing receptor (CaSR), which upon activation triggers rise in cytosolic Ca2+ concentration ([Ca2+]i). However, in a previous report [[11]], we have shown that BT474 cells do not express CaSR: absence of protein expression (Western blotting) and failure of the high level (10 mM) Ca2+ to elicit any Ca2+ signal. By contrast, a high level (3 mM) of Ca2+ elicited a Ca2+ elevation in bEND.3 endothelial cells, and Western blot analysis showed the presence of CaSR in bEND.3 cells [[11]]. Putting together, our data suggest that there was no functional expression of CaSR in BT474 cells and that spermine effects in BT474 cells were not via CaSR.

Graph: Figure 4: Ca2+ signaling triggered by polyamines. BT474 cells were stimulated with different concentrations of polyamines in Ca2+-containing solutions. Results are mean±SEM, each group having 62–208 cells from three to five separate experiments.

We then examined the spermine-elicited Ca2+ signal in Ca2+-free and Ca2+-containing solutions (Figure 5). We found that spermine induced a Ca2+ signal in Ca2+ free solution; it triggered a larger Ca2+ signal in Ca2+-containing solution, suggesting that spermine triggered both Ca2+ release from internal stores and Ca2+ influx (Figure 5A). For comparison, we used the same protocol to examine the effects of CPA. CPA is an inhibitor of endoplasmic reticulum (ER) Ca2+ pump and thus empties the Ca2+ store; the emptiness of the Ca2+ store elicits influx of extracellular Ca2+ into the cytosol, a mechanism termed "store-operated Ca2+ entry." As shown in Figure 5B, CPA also triggered both Ca2+ release from internal stores and Ca2+ influx. However, it is noticeable that the spermine-elicited Ca2+ influx was larger and more sustained.

Graph: Figure 5: Spermine-triggered Ca2+ signaling was composed of both Ca2+ release and Ca2+ influx. BT474 cells were stimulated by 10 mM spermine (A) or 30 μL CPA (B) in Ca2+-free or Ca2+-containing solutions. Results are mean±SEM, each group having 53–82 cells from four separate experiments.

Results in Figure 5 suggest that the spermine-triggered Ca2+ signal was composed of a Ca2+ influx component. We then examined if spermine triggered Mn2+ (Ca2+ surrogate) influx. As shown in Figure 6A, spermine did not accelerate Mn2+ influx; indeed, it inhibited the basal influx of Mn2+. As a control, the addition of digitonin caused a substantial acceleration of Mn2+ influx. As shown in Figure 6B, the addition of CPA expectedly accelerated the Mn2+ influx. These data suggest that the spermine-triggered Ca2+ influx pathway was not permeable to Mn2+.

Graph: Figure 6: Spermine did not trigger Mn2+ influx. (A) BT474 cells in Ca2+-containing solution were exposed to 1 mM Mn2+ before stimulated by DMSO, 10 μM digitonin, or 10 mM spermine. Significant differences (p<0.05) between DMSO and spermine group began at 233 s, and significant differences (p<0.05) between DMSO and digitonin group began at 272 s. (B) BT474 cells in Ca2+-containing solution were exposed to 1 mM Mn2+ before stimulated by DMSO or 30 μM CPA. Significant differences (p<0.05) between DMSO and CPA group began at 289 s. Results are mean±SEM, each group having 39–64 cells from six to nine separate experiments.

We next examined the relation of spermine-discharged Ca2+ pool to CPA-discharged pool. CPA is an inhibitor of the ER Ca2+ pump. As shown in Figure 7A, CPA caused a discharge of Ca2+ in Ca2+-free solution. If the cells were pretreated with spermine, there was no longer any Ca2+ discharge by CPA (Figure 7B). We then performed the experiment using a reverse order. In Figure 7C, spermine was observed to cause a substantial Ca2+ discharge. If the cells were pretreated with CPA, there was no longer any Ca2+ discharge by spermine (Figure 7D). These data suggest that the spermine-dischargeable pool and the CPA-dischargeable pool exactly overlapped. We examined if opening of the inositol 1,4,5-trisphosphate receptor-channel (IP3R) and the ryanodine receptor-channel (RYR) accounted for the spermine-triggered intracellular Ca2+ release (Figure 7E). We found that xestospongin C (XeC; inhibitor of IP3R) and JVT 519 fumarate (inhibitor of RYR), when added alone, partially suppressed spermine-triggered Ca2+ release and abolished spermine-triggered Ca2+ release when they were added together. These data suggest that the spermine-triggered Ca2+ release involved opening of both IP3R and RYR.

Graph: Figure 7: Ca2+ pools discharged by spermine and CPA exactly overlapped. (A and B) BT474 cells in Ca2+ free solution were pretreated with water or 10 mM spermine for 30 min before stimulated by 30 μM CPA. (C and D) BT474 cells in Ca2+-free solution were pretreated with DMSO or 30 μM CPA for 30 min before stimulated by 10 mM spermine. (E) BT474 cells in Ca2+-free solution were pretreated with DMSO, 2 μM XeC, 30 μM JVT, or 2 μM XeC plus 30 μM JVT for 10 min before challenged by 10 mM spermine. Results are mean±SEM, each group having 83–242 cells from four to eight separate experiments. Significant (p<0.05) differences between DMSO and XeC, DMSO and JVT, and DMSO and XeC plus JVT began at 409, 587, and 190 s, respectively.

As spermine caused Ca2+ release from Ca2+ stores and thus Ca2+ store emptiness, it could possibly cause ER stress. As shown in Figure 8, treatment with spermine and spermidine, but not putrescine, caused significant increase in protein expression of CHOP, an ER stress marker. The effects of the polyamines on the expression of phosphorylated eIF2α were not significant. Quantitative PCR results, however, revealed that only spermidine caused a very small increase in CHOP mRNA level at 2 h (Figure 9). The reason for this is unclear. As multiple factors, such as mRNA synthesis/degradation and protein translational control, may determine the steady-state protein concentration, there may not be a necessary correlation between mRNA and protein levels.

Graph: Figure 8: Effects of polyamines on expression of ER stress markers. BT474 cells were exposed to 10 mM each of spermine, spermidine, and putrescine and probed for ER stress marker expression by Western blot analysis. Results are mean±SEM from four separate experiments. *Significantly (p<0.05) different from control.

Graph: Figure 9: Effects of polyamines on CHOP mRNA levels. BT474 cells were exposed to 10 mM each of spermine, spermidine, and putrescine for 1 and 2 h, and CHOP mRNA levels were then quantified by quantitative PCR. Results are mean±SEM from three separate experiments. *Significantly (p<0.05) different from control.

To examine if the toxicity was related to oxidative stress, we measured ROS formation using flow cytometry (data in Supplement 1). Although hydrogen peroxide (positive control) elicited significant amount of ROS, 3–10 mM spermine did not trigger ROS production.

4 Discussion

Our data suggest that spermine acted on BT474 cells to cause cell growth inhibition/cell death and trigger Ca2+ signaling. The absence of CaSR protein expression and failure of high Ca2+ to trigger Ca2+ response in BT474 cells [[11]] do not support the notion of a CaSR mediating the effects of spermine. Rather, it is likely a putative polyamine receptor, as two other polyamines, namely, spermidine and putrescine, produced comparable effects on cell viability, apoptosis, and Ca2+ signaling. This putative polyamine receptor is considered a low-affinity one, as millimolar levels of polyamines were required for their effects. It is noted that polyamines reach millimolar levels inside the cells [[1]] and leakage of polyamines from damaged cells may allow polyamines to accumulate locally in the extracellular milieu. However, a definitive extracellular polyamine receptor is hitherto elusive. In view of the reported polyamine uptake into the cell by various polyamine transporters [[12]], [[13]], an intracellular polyamine receptor or receptors mediating the polyamine effects reported here is possible.

Polyamines have been shown to activate caspase and apoptosis in leukemia cells [[7]], bovine aortic endothelial cells, and rat aortic smooth muscle cells [[8]]. Our results that polyamines could increase caspase-3/7 activities are in concordance with these previous reports. Extracellular spermine and spermidine at millimolar levels have been shown to arrest mouse FM3A cell growth by depleting intracellular Mg2+ and ATP [[14]]. Inhibition of cell growth, apoptosis, and necrosis were observed when B16-F0 mouse melanoma tumor cells were exposed to bovine serum amine oxidase plus exogenous spermine, because of the enzymatic generation of cytotoxic products from spermine [[15]]. In our work, we showed that spermine cytotoxic effects were not due to oxidative stress, as spermine did not trigger ROS formation. The cytotoxic effects could be partly explained by ER stress, the latter consistent with Ca2+ store depletion caused by spermine.

Spermine caused a discharge of the CPA-sensitive Ca2+ pool, and this is very novel and unreported before. Our results suggest that spermine-triggered Ca2+ release involved opening of both IP3R and RYR. Although the spermine-dischargeable Ca2+ pool exactly overlapped with the CPA-sensitive Ca2+ pool (Figure 7), the kinetics of spermine-induced Ca2+ discharge was much more sustained, as if it were larger than the CPA-sensitive Ca2+ pool. One plausible explanation is that spermine slowed down Ca2+ extrusion, so that it took a longer period of time for complete clearance. Indeed, given enough time (30 min), spermine-induced Ca2+ signal did return to the baseline (Figure 7B).

Spermine triggered Ca2+ influx, which led to Ca2+ overload. We consider the involvement of voltage-gated Ca2+ channels unlikely as BT474 cells were not responsive to high extracellular K+, which would cause depolarization (data not shown). We also consider NMDA receptor unlikely to mediate spermine-triggered Ca2+ influx, as polyamines do not directly activate NMDA receptors but could only either enhance or suppress glutamate-mediated responses [[5]]. The spermine-triggered Ca2+ influx pore was Mn2+-impermeable, arguing strongly against the proposal that spermine activated Ca2+ influx via SOCC (which allows Mn2+ entry), albeit the fact that spermine did cause Ca2+ store depletion. Given that Mn2+ is a Ca2+ surrogate ion, such Mn2+ impermeability is very unusual. Further work will be warranted to characterize the pharmacological characteristics of this spermine-triggered Ca2+ influx pathway.

Polyamines have been implicated in perfused rat heart Ca2+ paradox, in which extracellular Ca2+ depletion renders myocardial cells susceptible to Ca2+ readmission, resulting in uncontrolled Ca2+ entry and massive acute cell damage [[16]]. However, it is hitherto unclear how exactly polyamines trigger Ca2+ influx during Ca2+ paradox. The effects of polyamines on Ca2+ transport appear to be variable in different cell types. It is notable that polyamine could inhibit Ca2+ signaling. For instance, polyamines have been shown to strongly inhibit concanavalin A-triggered Ca2+ influx in murine CD4+ T cells [[17]].

5 Conclusion

Spermine acted on BT474 cells to cause Ca2+ overload, Ca2+ store depletion, and ER stress, eventually leading to apoptotic cell death. In the future, potent ligands targeting a putative polyamine receptor (extracellular or intracellular) could be developed as novel anticancer agents against breast cancer cell growth.

Supplementary Material

The online version of this article offers supplementary material (https://doi.org/10.1515/znc-2019-0119).

Acknowledgments

Y.M.L. would like to thank China Medical University, Taiwan, for providing funding (CMU108-S-31, CMU107-S-01). L.W.C.C. would like to thank the Macau Science and Technology Development Fund (FUNDO PARA O DESENVOLVIMENTO DAS CIÊNCIAS E DA TECNOLOGIA) for support (grant number 002/2015/A1). K.C.W. thanks the Chang Gung Memorial Hospital, Chiayi, for support (CMRPG6J0371, CMRPG6G0541).

1 Murray-Stewart TR, Woster PM, Casero RA, Jr. Targeting polyamine metabolism for cancer therapy and prevention. Biochem J 2016;473:2937–53. 2 Pegg AE. S-Adenosylmethionine decarboxylase. Essays Biochem 2009;46:25–46. 3 Read GW, Hong SM, Kiefer EF. Competitive inhibition of 48/80-induced histamine release by benzalkonium chloride and its analogs and the polyamine receptor in mast cells. J Pharmacol Exp Ther 1982;222:652–7. 4 Geibel JP. The calcium-sensing receptor. J Nephrol 2010;Suppl 16:S130–5. 5 Williams K, Romano C, Dichter MA, Molinoff PB. Modulation of the NMDA receptor by polyamines. Life Sci 1991;48:469–98. 6 Guerra GP, Rubin MA, Mello CF. Modulation of learning and memory by natural polyamines. Pharmacol Res 2016;112:99–118. 7 Stefanelli C, Bonavita F, Stanic' I, Mignani M, Facchini A, Pignatti C, et al. Spermine causes caspase activation in leukaemia cells. FEBS Lett 1998;437:233–6. 8 Facchiano F, D'Arcangelo D, Riccomi A, Lentini A, Beninati S, Capogrossi MC. Transglutaminase activity is involved in polyamine-induced programmed cell death. Exp Cell Re. 2001;271:118–29. 9 Leung YM, Huang CF, Chao CC, Lu DY, Kuo CS, Cheng TH, et al. Voltage-gated K+ channels play a role in cAMP-stimulated neuritogenesis in mouse neuroblastoma N2A cells. J Cell Physiol 2011;226:1090–8. Lu DY, Tang CH, Yeh WL, Wong KL, Lin CP, Chen YH, et al. SDF-1alpha up-regulates interleukin-6 through CXCR4, PI3K/Akt, ERK, and NF-kappaB-dependent pathway in microglia. Eur J Pharmacol 2009;613:146–54. Chen CY, Hour MJ, Lin WC, Wong KL, Shiao LR, Cheng KS, et al. Antagonism of Ca2+-sensing receptors by NPS 2143 is transiently masked by p38 activation in mouse brain bEND.3 endothelial cells. Naunyn Schmiedebergs Arch Pharmacol 2019;392:823–32. Fukuchi J, Hiipakka RA, Kokontis JM, Nishimura K, Igarashi K, Liao S. TATA-binding protein-associated factor 7 regulates polyamine transport activity and polyamine analog-induced apoptosis. J Biol Chem 2004;279:29921–9. Sala-Rabanal M, Li DC, Dake GR, Kurata HT, Inyushin M, Skatchkov SN, et al. Polyamine transport by the polyspecific organic cation transporters OCT1, OCT2, and OCT3. Mol Pharm 2013;10:1450–8. He Y, Kashiwagi K, Fukuchi J, Terao K, Shirahata A, Igarashi K. Correlation between the inhibition of cell growth by accumulated polyamines and the decrease of magnesium and ATP. Eur J Biochem 1993;217:89–96. Averill-Bates DA, Ke Q, Tanel A, Roy J, Fortier G, Agostinelli E. Mechanism of cell death induced by spermine and amine oxidase in mouse melanoma cells. Int J Oncol 2008;32:79–88. Koenig H, Goldstone AD, Trout JJ, Lu CY. Polyamines mediate uncontrolled calcium entry and cell damage in rat heart in the calcium paradox. J Clin Invest 1987;80:1322–31. Thomas T, Gunnia UB, Yurkow EJ, Seibold JR, Thomas TJ. Inhibition of calcium signalling in murine splenocytes by polyamines: differential effects on CD4 and CD8 T-cells. Biochem J 1993;291:375–81. Conflict of interests: The authors declare no conflict of interests. Ethical approval: No humans or animals were used in this study; only cell lines were used in this work, and therefore, ethical approval is not required.

By Louis W.C. Chow; Kar-Lok Wong; Lian-Ru Shiao; King-Chuen Wu and Yuk-Man Leung

Reported by Author; Author; Author; Author; Author